View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-28 (Length: 127)
Name: Solexa-NF5877-28
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-28 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 79; Significance: 2e-37; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 79; E-Value: 2e-37
Query Start/End: Original strand, 9 - 127
Target Start/End: Original strand, 18253090 - 18253208
Alignment:
| Q |
9 |
ttgaattattactagacttgtatcattgtcataatttagtgtaatatatcgtgcaagttacgttttacaaaatcatctgaaactgtgatttaagatacga |
108 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| || |||||| | | ||| |
|
|
| T |
18253090 |
ttgaattattaatagacttgtatcattgtcataatttagtgtaatatatcgtgcaagttacgttttacataatcgtctgaaattgcgatttaggctgcga |
18253189 |
T |
 |
| Q |
109 |
catcaaggtttttgatgtc |
127 |
Q |
| |
|
||||| ||||| ||||||| |
|
|
| T |
18253190 |
catcatggtttatgatgtc |
18253208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University