View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-30 (Length: 127)
Name: Solexa-NF5877-30
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 20919792 - 20919673
Alignment:
| Q |
8 |
ggttgtactaaattcgattatctaaatcaagtctcatactaagtcccccatttccttaatgttagaatctacccgcgttactaatgattcttcattagaa |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
20919792 |
ggttgtactaaattcgattatttaaatcaagtctcatactaagtcccccatttccttaatgttagaatctacccgcgttactaatgattcttcatgagaa |
20919693 |
T |
 |
| Q |
108 |
cactcttttaatgtatcgta |
127 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
20919692 |
cactcttttaatatatcgta |
20919673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University