View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-31 (Length: 127)
Name: Solexa-NF5877-31
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 3e-58; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 28842659 - 28842542
Alignment:
| Q |
8 |
ctgctggtgtagttgaaggtcgcaagtgtacggcttttcctcctgtcaaaccggtattggttgcggctggtgttcattgggttgaacctgacaccatgtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28842659 |
ctgctggtgtagttgaaggtcgcaagtgtacggcttttcctcctgtcaaaccggtattggttgcggctggtgctcattgggttgaacctgacaccatgtc |
28842560 |
T |
|
| Q |
108 |
aacaactgtggtggatgg |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
28842559 |
aacaactgtggtggatgg |
28842542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 7e-16
Query Start/End: Original strand, 20 - 94
Target Start/End: Complemental strand, 28837898 - 28837824
Alignment:
| Q |
20 |
ttgaaggtcgcaagtgtacggcttttcctcctgtcaaaccggtattggttgcggctggtgttcattgggttgaac |
94 |
Q |
| |
|
|||||||| ||||||| || | |||||||||| |||||||||||||| |||| ||||||| |||||||||||||| |
|
|
| T |
28837898 |
ttgaaggttgcaagtgcacagattttcctcctctcaaaccggtattgattgcagctggtgctcattgggttgaac |
28837824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 20 - 125
Target Start/End: Complemental strand, 28828471 - 28828371
Alignment:
| Q |
20 |
ttgaaggtcgcaagtgtacggcttttcctcctgtcaaaccggtattggttgcggctggtgttcattgggttgaacctgacaccatgtcaacaactgtggt |
119 |
Q |
| |
|
||||||||| |||||| || |||||||||||| |||||| ||||||| |||| ||||||| | |||| |||| |||| |||||||||||||| || |
|
|
| T |
28828471 |
ttgaaggtcccaagtgcacagcttttcctcctctcaaactggtattgattgctgctggtgctttttggtttga-----acactatgtcaacaactgtagt |
28828377 |
T |
|
| Q |
120 |
ggatgg |
125 |
Q |
| |
|
|||||| |
|
|
| T |
28828376 |
ggatgg |
28828371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University