View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-36 (Length: 124)
Name: Solexa-NF5877-36
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-36 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 124
Target Start/End: Original strand, 28842012 - 28842135
Alignment:
| Q |
1 |
cggacgttggaggcgacaccgatggtaatttgagaaaacataagcgattgtatgtaatcacaagtctaagtatcgtgtcagtgtccgacacgtgtcgaac |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28842012 |
cggacattggaggcgacaccgatggtaatttgagaaaacataagtgattgtatgtaatcacaagtctaagtatcgtgtcagcgtccgacacgtgtcgaac |
28842111 |
T |
 |
| Q |
101 |
cagacaagccttcaatctcgaaaa |
124 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
28842112 |
cagacacgccttcaatctcgaaaa |
28842135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University