View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5877-47 (Length: 110)

Name: Solexa-NF5877-47
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5877-47
Solexa-NF5877-47
[»] chr6 (1 HSPs)
chr6 (4-110)||(18253521-18253628)


Alignment Details
Target: chr6 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 4 - 110
Target Start/End: Complemental strand, 18253628 - 18253521
Alignment:
4 aagaatgcaaacgattgatcacaattcaaccaattgtgtctacgtcttggacgataggggttgctgaccataatgtag-gtttttattaaacacttatct 102  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||  ||||||||||||||| ||||    
18253628 aagaatgcaaacgatcgatcacaattcaaccaattgtgtctacgtcttggacgatagaggttgctgacaataatgtagattttttattaaacactcatct 18253529  T
103 cgctatgc 110  Q
    ||||||||    
18253528 cgctatgc 18253521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University