View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-47 (Length: 110)
Name: Solexa-NF5877-47
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-47 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 80; Significance: 5e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 80; E-Value: 5e-38
Query Start/End: Original strand, 4 - 110
Target Start/End: Complemental strand, 18253628 - 18253521
Alignment:
| Q |
4 |
aagaatgcaaacgattgatcacaattcaaccaattgtgtctacgtcttggacgataggggttgctgaccataatgtag-gtttttattaaacacttatct |
102 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
18253628 |
aagaatgcaaacgatcgatcacaattcaaccaattgtgtctacgtcttggacgatagaggttgctgacaataatgtagattttttattaaacactcatct |
18253529 |
T |
 |
| Q |
103 |
cgctatgc |
110 |
Q |
| |
|
|||||||| |
|
|
| T |
18253528 |
cgctatgc |
18253521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University