View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-55 (Length: 64)
Name: Solexa-NF5877-55
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-55 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 8 - 43
Target Start/End: Original strand, 27811750 - 27811785
Alignment:
| Q |
8 |
ctaacatatatcgtgaccggcatgtaaagaataatg |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27811750 |
ctaacatatatcgtgaccggcatgtaaagaataatg |
27811785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University