View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5877-9 (Length: 153)
Name: Solexa-NF5877-9
Description: NF5877
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5877-9 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 7 - 153
Target Start/End: Complemental strand, 38952057 - 38951910
Alignment:
| Q |
7 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttt-gcatgctgtgcataatttataaggaagaagcgtggacgaca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38952057 |
cagagaccgtgattgttaaatgaagtagctaattgaaaatctttcttcatgaatcttttgcatgctgtgcataatttataaggaagaagcgtggacgaca |
38951958 |
T |
|
| Q |
106 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacg |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38951957 |
agaaataaagccatggtcccctcaccactgattccagctaatagcacg |
38951910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University