View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5878-11 (Length: 129)
Name: Solexa-NF5878-11
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5878-11 |
 | |
|
| [»] chr8 (3 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 3e-58; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 8 - 129
Target Start/End: Original strand, 21180582 - 21180703
Alignment:
| Q |
8 |
gagaagtctaacaagattattgtgttggagttttgcaatcaacaatgcttcatttcgcaactcctcccatccttgacctgatcttcgagatagccttttt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21180582 |
gagaagtctaacaagattattgtgttggagtttcgcaatcaacaatgcttcatttcgcaactcctcccatccttgacctgatattcgagatagccttttt |
21180681 |
T |
|
| Q |
108 |
atcgcgacctcacccccattca |
129 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
21180682 |
atcgcgacctcacccccattca |
21180703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 23189364 - 23189243
Alignment:
| Q |
8 |
gagaagtctaacaagattattgtgttggagttttgcaatcaacaatgcttcatttcgcaactcctcccatccttgacctgatcttcgagatagccttttt |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23189364 |
gagaagtctaacaagattattatgttggagttttgcaattaacaatgcttcatttcttaactcctcccatccttgacccgatcttcgagatagccttttt |
23189265 |
T |
|
| Q |
108 |
atcgcgacctcacccccattca |
129 |
Q |
| |
|
| || |||||| ||||||||| |
|
|
| T |
23189264 |
acagcaacctcatccccattca |
23189243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 74; E-Value: 2e-34
Query Start/End: Original strand, 8 - 129
Target Start/End: Complemental strand, 23181987 - 23181866
Alignment:
| Q |
8 |
gagaagtctaacaagattattgtgttggagttttgcaatcaacaatgcttcatttcgcaactcctcccatccttgacctgatcttcgagatagccttttt |
107 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||||||||||||||| || ||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
23181987 |
gagaagtctaacaagattattatgctggagttttgcaatcaacaatgcttcatttcttaattcctcccatccttgaccggatcttcgggatagccttttc |
23181888 |
T |
|
| Q |
108 |
atcgcgacctcacccccattca |
129 |
Q |
| |
|
| || |||||| ||||||||| |
|
|
| T |
23181887 |
acagcaacctcatccccattca |
23181866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University