View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5878-12 (Length: 127)
Name: Solexa-NF5878-12
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5878-12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000004; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000004
Query Start/End: Original strand, 74 - 120
Target Start/End: Original strand, 38598953 - 38599000
Alignment:
| Q |
74 |
cgtggatcaaggaaaacggagaagtttgtttataag-ttagccacttt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38598953 |
cgtggatcaaggaaaacggagaagtttgtttataagcttagccacttt |
38599000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 45
Target Start/End: Original strand, 38598796 - 38598833
Alignment:
| Q |
8 |
tgagtcactcaattcattcaattgttatgaagttctga |
45 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38598796 |
tgagtcactcaattcattcaattgttaagaagttctga |
38598833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.0000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.0000000006
Query Start/End: Original strand, 9 - 45
Target Start/End: Complemental strand, 39953697 - 39953661
Alignment:
| Q |
9 |
gagtcactcaattcattcaattgttatgaagttctga |
45 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39953697 |
gagtcactcaattcattcaattattatgaagttctga |
39953661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University