View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5878-13 (Length: 126)
Name: Solexa-NF5878-13
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5878-13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 88 - 124
Target Start/End: Complemental strand, 7370856 - 7370820
Alignment:
| Q |
88 |
gtataatccacatttttatttaacaaatgcaatatta |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7370856 |
gtataatccacatttttatttaacaaatgcaatatta |
7370820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University