View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5878-14 (Length: 114)
Name: Solexa-NF5878-14
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5878-14 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 93; Significance: 9e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 93; E-Value: 9e-46
Query Start/End: Original strand, 10 - 114
Target Start/End: Complemental strand, 21181576 - 21181472
Alignment:
| Q |
10 |
taataataataaaccaaatttttatctcagacttgctggctcagacttgcttcccccaagtaagttgaaggaacctactttatctttccttttctttttc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21181576 |
taataataataaaccaaatttttatctcagacttgctggctcggacttgcttcccccaagtaagttgaaggaacctactttacctttccttttctttttt |
21181477 |
T |
 |
| Q |
110 |
atatc |
114 |
Q |
| |
|
||||| |
|
|
| T |
21181476 |
atatc |
21181472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University