View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5878-6 (Length: 145)
Name: Solexa-NF5878-6
Description: NF5878
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5878-6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 3e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 7 - 142
Target Start/End: Complemental strand, 32423612 - 32423477
Alignment:
| Q |
7 |
aatatgctactgataatgctaaattttttaaagcctttgccaagggtatggtcaaaatgagtagcatcaagcccctcacaggaagcaatggacagatcag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32423612 |
aatatgctactgataatgctaaattttttaaagcctttgccaagggtatggtcaaaatgagtagcatcaagcccctcacaggaagcaatggacagatcag |
32423513 |
T |
|
| Q |
107 |
aaccaattgcagaaaaatcaactgaaaattagtaat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
32423512 |
aaccaattgcagaaaaatcaactgaaaattagtaat |
32423477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 90; E-Value: 7e-44
Query Start/End: Original strand, 7 - 139
Target Start/End: Complemental strand, 32430714 - 32430579
Alignment:
| Q |
7 |
aatatgctactgataatgctaaattttttaaagcctttgccaagggtatggtcaaaatgagtag---catcaagcccctcacaggaagcaatggacagat |
103 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| |||| ||||||||||||||||| |||||| ||||| |||||||||||||||||||| |
|
|
| T |
32430714 |
aatatgctactaataatgctgaattttttaaagcctttgccgagggcatggtcaaaatgagtagtagcatcaaaccccttacaggaagcaatggacagat |
32430615 |
T |
|
| Q |
104 |
cagaaccaattgcagaaaaatcaactgaaaattagt |
139 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
32430614 |
cagaatcaattgcagaaaaaccaactgaaaattagt |
32430579 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University