View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5879-16 (Length: 127)

Name: Solexa-NF5879-16
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5879-16
Solexa-NF5879-16
[»] chr4 (1 HSPs)
chr4 (8-127)||(47893968-47894087)
[»] scaffold0320 (1 HSPs)
scaffold0320 (26-64)||(19832-19870)
[»] chr1 (1 HSPs)
chr1 (26-64)||(50680695-50680733)


Alignment Details
Target: chr4 (Bit Score: 120; Significance: 8e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 47893968 - 47894087
Alignment:
8 taatttaattgggaatcaaaattagggtattattaggaataagaatgaaatgaattgacgtaccatgtttctatgtggtgatgataacaagaaggttagg 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47893968 taatttaattgggaatcaaaattagggtattattaggaataagaatgaaatgaattgacgtaccatgtttctatgtggtgatgataacaagaaggttagg 47894067  T
108 tgagaactcaaagaattgaa 127  Q
    ||||||||||||||||||||    
47894068 tgagaactcaaagaattgaa 47894087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0320 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: scaffold0320
Description:

Target: scaffold0320; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 19870 - 19832
Alignment:
26 aaattagggtattattaggaataagaatgaaatgaattg 64  Q
    ||||||||||||||||| || ||||||||||||||||||    
19870 aaattagggtattattatgactaagaatgaaatgaattg 19832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 64
Target Start/End: Complemental strand, 50680733 - 50680695
Alignment:
26 aaattagggtattattaggaataagaatgaaatgaattg 64  Q
    ||||||||||||||||| || ||||||||||||||||||    
50680733 aaattagggtattattatgactaagaatgaaatgaattg 50680695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University