View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5879-19 (Length: 103)
Name: Solexa-NF5879-19
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5879-19 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 93; Significance: 8e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 8e-46
Query Start/End: Original strand, 7 - 103
Target Start/End: Original strand, 1328663 - 1328759
Alignment:
| Q |
7 |
aggattgcggtggcagcgtcgagaccggagttttttggtgtgaaaggggatggtgagaaattggagattaggacttggaagaagaatagtgatgttt |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1328663 |
aggattgcggtggcagcgtcgagaccggagttttttggtgtgaaaggggatggtgagaaattggagattaggaattggaagaagaatagtgatgttt |
1328759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University