View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5879-3 (Length: 220)
Name: Solexa-NF5879-3
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5879-3 |
 | |
|
| [»] scaffold0128 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 55 - 217
Target Start/End: Original strand, 7329323 - 7329480
Alignment:
| Q |
55 |
aatgacaagttatgactttaagagtgtcgtgtcnnnnnnnnnnncatcggttaatgcaacactaatactaaccaagtaagagctacaatagatcttttca |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7329323 |
aatgacaagttatgactttaagagtgtcgtgtctttttt-----catcggttaatgctacactaatactaaccacctaagagctacaatagatcttttca |
7329417 |
T |
|
| Q |
155 |
tatcacaattgaacatttatgtttttatattgaattatacactattccatttttggtatatct |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7329418 |
tatcacaattgaacatttatgtttttatattgaattatacactattccatttttggtatatct |
7329480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 133 - 176
Target Start/End: Original strand, 6178 - 6221
Alignment:
| Q |
133 |
agagctacaatagatcttttcatatcacaattgaacatttatgt |
176 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
6178 |
agagctacaatagatcttttattatcaaaattgaacatttatgt |
6221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University