View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5879-9 (Length: 141)
Name: Solexa-NF5879-9
Description: NF5879
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5879-9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 2 - 140
Target Start/End: Original strand, 42894990 - 42895128
Alignment:
| Q |
2 |
agagagaaggaattgcacgttgaaatttaagactaaatggttggcaactaatgagggtaattaaatgtgaaagttgactttatttaagattgcttgctaa |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42894990 |
agagagaaggaattgcacgttgaaatttaagactaaatggttggcaactaatgagggtaattaaatgtgaaagttgactttatttaagattgcttgctaa |
42895089 |
T |
 |
| Q |
102 |
caatttcgatcatcatagcaaatttaattttctgatttc |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42895090 |
caatttcgatcatcatagcaaatttaattttctaatttc |
42895128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University