View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-13 (Length: 142)
Name: Solexa-NF5880-13
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-13 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 1e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 1e-39
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 5080471 - 5080328
Alignment:
| Q |
1 |
agatgaaaattgtaggatcgtgtaggcatctattataaagttggaagaaaaaggccttaatgaatcacaaattaaatgggggagattaatcactttggtc |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| ||||| |||| ||||||| ||| |
|
|
| T |
5080471 |
agatgaaaattgtaggatcatgtaggcatttattataaagttggaagaaaaaggccttaatgaatcacaaactaaat-ggggaaattagtcactttagtc |
5080373 |
T |
|
| Q |
101 |
ccttaataagaaaga---cgtcattttagtccctgaatgcagata |
142 |
Q |
| |
|
|| |||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
5080372 |
tctgaataggaaagaagtcgttattttagtccctgaatgcagata |
5080328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 80 - 142
Target Start/End: Complemental strand, 38761276 - 38761211
Alignment:
| Q |
80 |
gggagattaatcactttggtcccttaataagaa---agacgtcattttagtccctgaatgcagata |
142 |
Q |
| |
|
||||||||||||||||| |||||| |||| ||| || | ||| ||||||||||||||||||||| |
|
|
| T |
38761276 |
gggagattaatcactttagtccctgaataggaaatgagtcatcactttagtccctgaatgcagata |
38761211 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 80 - 142
Target Start/End: Complemental strand, 13753513 - 13753448
Alignment:
| Q |
80 |
gggagattaatcactttggtcccttaataagaaaga---cgtcattttagtccctgaatgcagata |
142 |
Q |
| |
|
||||||||| ||||||| |||||| |||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
13753513 |
gggagattagtcactttagtccctaaataggaaagaagtcgtcattttagtctctgaatgcagata |
13753448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University