View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-14 (Length: 141)
Name: Solexa-NF5880-14
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-14 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 5e-51; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 46894649 - 46894516
Alignment:
| Q |
8 |
tttagagcacctatagactatattggagaattcttaccatatttaatactttgttaaactgattatgttatcatggtatcattaaaacaggtgcctatag |
107 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46894649 |
tttagagcacctatagactataatggagaatccttaccatatttaatactttgttaaactgattatgttatcatggtatcattaaaacaggtgcctatag |
46894550 |
T |
 |
| Q |
108 |
agaattatgnnnnnnnnaatcactctctccgatc |
141 |
Q |
| |
|
||||||||| ||||||||||||||||| |
|
|
| T |
46894549 |
agaattatgttttttttaatcactctctccgatc |
46894516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University