View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-18 (Length: 137)
Name: Solexa-NF5880-18
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-18 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 119; Significance: 3e-61; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 1 - 137
Target Start/End: Original strand, 34441604 - 34441737
Alignment:
| Q |
1 |
tgagatgaatgtcataatccctccaatttcattaacagtacttgatatcttttaataatgatgatacccttgagatataaataagcagctcagaatataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34441604 |
tgagatgaatgtcataatccctccaatttcattaacagtacttgatatcttttaataatgatgatacccttgagatataaataagcag---agaatataa |
34441700 |
T |
|
| Q |
101 |
gggttgagtttgttggagtaatattctcatagtttgt |
137 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34441701 |
gggttgagttttttggagtaatattctcatagtttgt |
34441737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 97 - 137
Target Start/End: Original strand, 34451538 - 34451578
Alignment:
| Q |
97 |
ataagggttgagtttgttggagtaatattctcatagtttgt |
137 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
34451538 |
ataagggttgaatctgttggagtaatattctcatagtttgt |
34451578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 34467341 - 34467380
Alignment:
| Q |
1 |
tgagatgaatgtcataatccctccaatttcattaacagta |
40 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
34467341 |
tgagatgaatgtcatgatccctccagtttcattaacagta |
34467380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University