View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-20 (Length: 136)
Name: Solexa-NF5880-20
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-20 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 2e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 2e-71
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 50501762 - 50501627
Alignment:
| Q |
1 |
cccacaaattatttgttttcatcccttgcaatgattattaggtgtaatgtaatgatccaataaacaataggggtatgcatgtgctatgtggattgtttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50501762 |
cccacaaattatttgttttcatcccttgcaatgattattaggtgtaatgtaatgatccaataaacaataggggtatgcatgtgctatgtggattgtttct |
50501663 |
T |
 |
| Q |
101 |
ctggcacttcccgtatcctcggctttgttttgttgt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
50501662 |
ctggcacttcccgtatcctcggctttgttttgttgt |
50501627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University