View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-21 (Length: 135)
Name: Solexa-NF5880-21
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 10560811 - 10560700
Alignment:
| Q |
1 |
caaagggatatagcctaaaataggtgaaagaaaaatgaagcaattgttttcttttaaacatgacacttcgacattgggcaagtttttgcaagtgctcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10560811 |
caaagggatatagcctaaaataggtgaaagaaaaatgaagcaattgttttcttttaaacatgacacttcgacattgggcaagtttttgcaagtgctcttg |
10560712 |
T |
 |
| Q |
101 |
atcaatacctta |
112 |
Q |
| |
|
||||| |||||| |
|
|
| T |
10560711 |
atcaacacctta |
10560700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 5e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 41 - 105
Target Start/End: Original strand, 26159132 - 26159195
Alignment:
| Q |
41 |
caattgttttcttttaaacatgacacttcgacattgggcaagtttttgcaagtgctcttgatcaa |
105 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
26159132 |
caattgttttcttttaaacat-acacttggacactgggcaagtgtttgcaagtgctcttgatcaa |
26159195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000003; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 55780962 - 55780998
Alignment:
| Q |
25 |
tgaaagaaaaatgaagcaattgttttcttttaaacat |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55780962 |
tgaaagaaaaatgaagcaattgttttcttttaaacat |
55780998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 55845142 - 55845178
Alignment:
| Q |
25 |
tgaaagaaaaatgaagcaattgttttcttttaaacat |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55845142 |
tgaaagaaaaatgaagcaattgttttcttttaaacat |
55845178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 25 - 61
Target Start/End: Original strand, 19852309 - 19852345
Alignment:
| Q |
25 |
tgaaagaaaaatgaagcaattgttttcttttaaacat |
61 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19852309 |
tgaaagaaaaatgaagcaattgttttcttttaaacat |
19852345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University