View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-25 (Length: 130)
Name: Solexa-NF5880-25
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-25 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 91; Significance: 2e-44; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 91; E-Value: 2e-44
Query Start/End: Original strand, 7 - 130
Target Start/End: Complemental strand, 25209537 - 25209408
Alignment:
| Q |
7 |
agctgttgctaaagtttttctatttatttattttgatgggttagatgaagtttaggtttgtgtgacataca------tcatatgtgtctatatatattga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
25209537 |
agctgttgctaaagtttttctatttatttattttgatgggttagatgaaatataggtttgtgtgacatatatcatattcatatgtgtctatatatattga |
25209438 |
T |
 |
| Q |
101 |
agtatagtttgcaacactttgtgatcttag |
130 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |
|
|
| T |
25209437 |
agtatagtttacaacactttgtgatcttag |
25209408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University