View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-27 (Length: 127)
Name: Solexa-NF5880-27
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-27 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 4e-54; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 4e-54
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 6371882 - 6371761
Alignment:
| Q |
8 |
cttcttccacttcccatttgaaacatgataagagaatgaaatagttcaaagtttcaagcttttttgttttagcaggagaacaacaagaagac--agaaaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6371882 |
cttcttccacttcccatttgaaacatgataagagaatgaaatagttcaaagtttcaagcttttttgttttagcaggagaacaacaagaagacaaagaaaa |
6371783 |
T |
|
| Q |
106 |
agaaactattttttattcacca |
127 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
6371782 |
agacactattttttattcacca |
6371761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University