View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5880-30 (Length: 124)

Name: Solexa-NF5880-30
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5880-30
Solexa-NF5880-30
[»] chr5 (1 HSPs)
chr5 (2-124)||(28716709-28716831)
[»] chr1 (1 HSPs)
chr1 (2-124)||(16490341-16490463)


Alignment Details
Target: chr5 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 2 - 124
Target Start/End: Original strand, 28716709 - 28716831
Alignment:
2 taggtggaggaagtgcttaccattcagagttatctgccatcatgagggccactgagattgctttcagtcgaggttggaggaatgtatggattgaaacaga 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
28716709 taggtggaggaagtgcttaccattcagagttatctgccatcatgagagccactgagattgctttcagtcgaggttggaggaatgtatggattgaaacaga 28716808  T
102 ctcttcgttagtggtcatggctt 124  Q
    |||||||||||||||||||||||    
28716809 ctcttcgttagtggtcatggctt 28716831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 2 - 124
Target Start/End: Original strand, 16490341 - 16490463
Alignment:
2 taggtggaggaagtgcttaccattcagagttatctgccatcatgagggccactgagattgctttcagtcgaggttggaggaatgtatggattgaaacaga 101  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
16490341 taggtggaggaagtgcttaccattcagagttatctgccatcatgagagccactgagattgctttcagtcgaggttggaggaatgtatggattgaaacaga 16490440  T
102 ctcttcgttagtggtcatggctt 124  Q
    |||||||||||||||||||||||    
16490441 ctcttcgttagtggtcatggctt 16490463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University