View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-31 (Length: 123)
Name: Solexa-NF5880-31
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-31 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 123
Target Start/End: Complemental strand, 3266804 - 3266689
Alignment:
| Q |
8 |
ctagagatactagaaaaatgtcaacaaaattatagtgtgttaacaaaacaaaattataaaatccttctattttaaagtacatctattttcatgcctcgtc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3266804 |
ctagagatactagaaaaatgtcaacaaaattatagtgtgttaacaaaacaaaattataaaatccttctattttaaagtacatctattttcatgcctcgtc |
3266705 |
T |
|
| Q |
108 |
accgggtgcttatttc |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3266704 |
accgggtgcttatttc |
3266689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 38 - 105
Target Start/End: Complemental strand, 12642712 - 12642645
Alignment:
| Q |
38 |
tatagtgtgttaacaaaacaaaattataaaatccttctattttaaagtacatctattttcatgcctcg |
105 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| |||| || ||||| ||||||||| |||| ||||| |
|
|
| T |
12642712 |
tatagtgtgttaacaagacaaaagtataaaatctttctcttctaaagcacatctattgtcattcctcg |
12642645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 38 - 89
Target Start/End: Complemental strand, 12644546 - 12644495
Alignment:
| Q |
38 |
tatagtgtgttaacaaaacaaaattataaaatccttctattttaaagtacat |
89 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||| |||| || |||||||||| |
|
|
| T |
12644546 |
tatagtgtgttaacgagacaaaagtataaaatctttctcttctaaagtacat |
12644495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University