View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-33 (Length: 112)
Name: Solexa-NF5880-33
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-33 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 4 - 112
Target Start/End: Complemental strand, 40693759 - 40693650
Alignment:
| Q |
4 |
aagaaaaaagttatatgaaacaaatatttcaaccccaaaagaattgatgaataatattaaaaacatggc-ccaggatcagaaattgaagaaccaaattca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
40693759 |
aagaaaaaagttatatgaaacaaatatttcaactccaaaagaattgatgaataatattaaaaacatggcaccaggatcaggaattgaagaaccaaattca |
40693660 |
T |
|
| Q |
103 |
atttaaacaa |
112 |
Q |
| |
|
|||||||||| |
|
|
| T |
40693659 |
atttaaacaa |
40693650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University