View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-34 (Length: 110)
Name: Solexa-NF5880-34
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-34 |
 |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 1e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 8 - 98
Target Start/End: Complemental strand, 165859 - 165769
Alignment:
| Q |
8 |
taattaacttataattcggcttgattgtgaaagcttagtatcaaattacattgtttatagcctatgttgttaattaccttcaatccttctg |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
165859 |
taattaacttataattcggcttgattgtgaaagcttagtatcaaattacattgtttatagcctatgttgttaattaccttcaatccttctg |
165769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 33; Significance: 0.0000000005; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 34 - 98
Target Start/End: Original strand, 91575 - 91639
Alignment:
| Q |
34 |
gtgaaagcttagtatcaaattacattgtttatagcctatgttgttaattaccttcaatccttctg |
98 |
Q |
| |
|
||||||||||| |||||||||| | || |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
91575 |
gtgaaagcttattatcaaattatgctattcatagcctatgttgttagttaccttcaaaccttctg |
91639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University