View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-36 (Length: 106)
Name: Solexa-NF5880-36
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-36 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 83; Significance: 8e-40; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 83; E-Value: 8e-40
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 34185134 - 34185028
Alignment:
| Q |
1 |
agttgtaggtgcatgc-attgatgaccattgatggttattccgcgtcaagaaattggatgaaacgtttcttagcactttttcttaacccctcaacgaagt |
99 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |||||||||||| ||||||||||| |
|
|
| T |
34185134 |
agttgtaggtgcatgccattgatgaccattgatggttattccgcgtcaagaaattggatgaaacgtttctcaacaatttttcttaaccgctcaacgaagt |
34185035 |
T |
|
| Q |
100 |
caacaac |
106 |
Q |
| |
|
||||||| |
|
|
| T |
34185034 |
caacaac |
34185028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University