View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5880-42 (Length: 63)

Name: Solexa-NF5880-42
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5880-42
Solexa-NF5880-42
[»] chr4 (1 HSPs)
chr4 (8-42)||(47621471-47621505)


Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Original strand, 47621471 - 47621505
Alignment:
8 atagttgcctctgatatggagggatatgggtgatc 42  Q
    |||||||||||||||||||||||||||||||||||    
47621471 atagttgcctctgatatggagggatatgggtgatc 47621505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University