View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-6 (Length: 179)
Name: Solexa-NF5880-6
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-6 |
 |  |
|
| [»] chr1 (135 HSPs) |
 |  |
|
| [»] chr4 (146 HSPs) |
 |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0038 (2 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |
|
| [»] scaffold1185 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (2 HSPs) |
 |  |  |
|
| [»] scaffold0157 (2 HSPs) |
 |  |  |
|
| [»] scaffold0394 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0254 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |  |
|
| [»] scaffold0113 (1 HSPs) |
 |  |  |
|
| [»] scaffold0330 (1 HSPs) |
 |  |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
| [»] scaffold0179 (1 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0199 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 1e-60; HSPs: 135)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 12662581 - 12662759
Alignment:
| Q |
1 |
agaacgaacatcaatccaatggctacctctcaaaagagsactataaatgataatgttaatggtcaagttccactgaacctgcatagtaaaacttggtttt |
100 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12662581 |
agaacgaacatcaatccattggttacctctcaaaagagcactataaatgataatgttaatggtcgagttccactgaacctgcatagtaaaacttggtttt |
12662680 |
T |
 |
| Q |
101 |
gttatccccgtgagcttaactcagttgat-agagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||| ||||||||||| ||||||| || || |||||||||||||||||||||| || || |||||||||||| |||| |
|
|
| T |
12662681 |
gttatctccgtgagcttagctcagttaataagggatattgcatattatatgcaggggc-cggagttcgaaactcggacac |
12662759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 2352639 - 2352580
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2352639 |
tatccccgtgagcttagctcagttgatagagatattgcatattatatgcaggagccgggg |
2352580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 40519619 - 40519552
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40519619 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggggttcgaa |
40519552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 25999846 - 25999905
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25999846 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
25999905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 26550489 - 26550549
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
26550489 |
ttatccccgtgagcttaactcagttggtagggatattgcatactatatgcaggagccgggg |
26550549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 1570266 - 1570207
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1570266 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
1570207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 4553619 - 4553564
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||||| |||| |
|
|
| T |
4553619 |
atccccgtgagcttaactcagttggtagaaatattgcatattatatgcaggggctg |
4553564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 6438138 - 6438079
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6438138 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
6438079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 46965736 - 46965795
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
46965736 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
46965795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 3269616 - 3269674
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
3269674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 7166300 - 7166242
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
7166242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 11065117 - 11065167
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11065117 |
atccccgtgagcttagctcagatgatagagatattgcatattatatgcagg |
11065167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 15819674 - 15819616
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
15819616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 26584821 - 26584767
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
26584821 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
26584767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 102 - 152
Target Start/End: Original strand, 44732628 - 44732678
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
44732628 |
ttatccccgtgagcttaactcagttggtagggatattgcatattatatgca |
44732678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 50899583 - 50899525
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
50899525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 4482671 - 4482618
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
4482618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 6702573 - 6702637
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
6702637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 8984581 - 8984520
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| |||||||||||||||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
8984581 |
gttatctccgtgagcttaactcagttggcagggatattgcatattatatgcaggagccgggg |
8984520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 32594248 - 32594312
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
32594248 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
32594312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 106 - 162
Target Start/End: Original strand, 16343027 - 16343083
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
16343083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 22563381 - 22563433
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22563381 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22563433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 25580689 - 25580737
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
25580689 |
ccgtgagcttaactcagttggtagagatattgcatattatatgccggag |
25580737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 33254725 - 33254777
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33254777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 33274897 - 33274949
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
33274949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 48638527 - 48638587
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
48638527 |
ttatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggctgggg |
48638587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 1151754 - 1151809
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||| ||||||| |
|
|
| T |
1151754 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatacaggagc |
1151809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 2556552 - 2556611
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| |||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
2556552 |
tatccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
2556611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 6130108 - 6130042
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||| || |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
6130108 |
ttatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
6130042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 7191028 - 7191087
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||| |||| |||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
7191028 |
tatctccgtgaccttagctcagttgatagggatattgcatattatatgcaggggctgggg |
7191087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 13773164 - 13773223
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
13773164 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
13773223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 15775734 - 15775789
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
15775734 |
ttattcccgtgagcttaactcaattggtagggatattgcatattatatgcaggagc |
15775789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 18467272 - 18467213
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| || |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
18467272 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggggctgggg |
18467213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 35605697 - 35605646
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35605697 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35605646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 40375389 - 40375330
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
40375389 |
tatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccgggg |
40375330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 43884790 - 43884849
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43884790 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
43884849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 2277755 - 2277809
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2277755 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
2277809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 8865851 - 8865901
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8865901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 21265653 - 21265703
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
21265653 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
21265703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 33207202 - 33207252
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33207202 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33207252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 42490483 - 42490433
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
42490433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 52426982 - 52426936
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
52426982 |
ccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
52426936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 10664867 - 10664818
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
10664867 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
10664818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 14760823 - 14760769
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||| |||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
14760823 |
tatccccgtgagcttagctcagttggtaga--tattgcatattatatgcaggagctg |
14760769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 16526250 - 16526197
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| |||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
16526250 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcaggagc |
16526197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 108 - 169
Target Start/End: Original strand, 18534002 - 18534062
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
18534002 |
ccgtgagcttagctcagttggtagagatattgcatattatatgtaggag-tcggggttcgaa |
18534062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 23545529 - 23545472
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||||||||| | || ||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
23545529 |
ttatccccgtgagctaagcttagttggtagggatattgcatattatatgcaggagctg |
23545472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 29188626 - 29188691
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
29188626 |
tttttttatccccgtgattttagctcagttggtagggatattgcatattatatgcaggagcagggg |
29188691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 34058215 - 34058264
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
34058215 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
34058264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 6893312 - 6893260
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
6893312 |
ttatccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
6893260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 107 - 179
Target Start/End: Complemental strand, 34656465 - 34656394
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||| ||||||||||| | | |||||||||| |||| |||| |
|
|
| T |
34656465 |
cccgtgagtttagctcagttgatagagatattgcattttatatgcagg-ggttggggttcgaacctcggacac |
34656394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 9866254 - 9866207
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9866207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 108 - 159
Target Start/End: Original strand, 11215002 - 11215053
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
11215002 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctg |
11215053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 171
Target Start/End: Complemental strand, 12502327 - 12502261
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaac |
171 |
Q |
| |
|
|||||||| ||| || |||||||| ||| |||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
12502327 |
atccccgtaagcatagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaaac |
12502261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 15390220 - 15390267
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
15390220 |
cccgtgagcttaactcagttggtagggatattgcatattagatgcagg |
15390267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 19011351 - 19011410
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||||||| |||| ||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19011351 |
tatctccgtgagcttagctcaattggtagggatattgcatattatatgcaggggctgggg |
19011410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 34580860 - 34580801
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| | | |||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
34580860 |
tatccccgtgagttcagctcagttggtagggatattgtatattatatgcaggagctgggg |
34580801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 42848806 - 42848755
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||| ||| |||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
42848806 |
ttattcccatgagcttagctcagttgatagggatattgcatattatatgcag |
42848755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 155
Target Start/End: Complemental strand, 43668030 - 43667979
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
|||||||| |||||| ||||||| ||||||||||||||||||||||||||| |
|
|
| T |
43668030 |
atccccgtaagcttagctcagttcgtagagatattgcatattatatgcagga |
43667979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 47402737 - 47402686
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| ||||| || ||| |||||||||||||||||||||| |
|
|
| T |
47402737 |
tatccccgtgagcttagctcagctggtagggatattgcatattatatgcagg |
47402686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 150
Target Start/End: Complemental strand, 48607823 - 48607776
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| ||||||| |
|
|
| T |
48607823 |
tatccccgtgagtttaactcagttgatagggatattgcattttatatg |
48607776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 1836500 - 1836550
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
1836500 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
1836550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 101 - 151
Target Start/End: Original strand, 2754354 - 2754404
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
|||||||||||||||||| || ||||| ||| ||||||||||||||||||| |
|
|
| T |
2754354 |
gttatccccgtgagcttagcttagttggtagggatattgcatattatatgc |
2754404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 18551706 - 18551656
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
18551706 |
atccccgtgagcttagctcagttggtatggatattgcatattatatgcagg |
18551656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 33033127 - 33033173
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33033127 |
ccgtgagcttaattcagttggtagggatattgcatattatatgcagg |
33033173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 103 - 153
Target Start/End: Original strand, 35283497 - 35283547
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||| ||||||||||||| || ||||||| |||||||||||||| |
|
|
| T |
35283497 |
tatccccgtgaacttaactcagttggtaaagatattacatattatatgcag |
35283547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 37662630 - 37662580
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
37662630 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
37662580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 40520827 - 40520885
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| ||| |||||||| ||| |||||||||||||||||||| | ||||||| |
|
|
| T |
40520827 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcatgggctgggg |
40520885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 42054330 - 42054376
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
42054330 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
42054376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 47478921 - 47478875
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| ||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
47478921 |
atcctcgtgagcttaactcagttggtagggatattgcatattatatg |
47478875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 48897190 - 48897140
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
48897190 |
atccccgtgagcttaactcatttggtaggaatattgcatattatatgcagg |
48897140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 51050187 - 51050237
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
51050187 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
51050237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 149
Target Start/End: Complemental strand, 11081288 - 11081244
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
11081288 |
atccccgtgagcttaactcagttgctag-gatattgcatattatat |
11081244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 152
Target Start/End: Original strand, 44019272 - 44019321
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| ||||||||||| |||||||||||| |||||||||| ||||||||| |
|
|
| T |
44019272 |
tatctccgtgagcttagctcagttgatagggatattgcattttatatgca |
44019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 121 - 162
Target Start/End: Complemental strand, 50824466 - 50824425
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
50824466 |
tcagttggtagggatattgcatattatatgcaggagctgggg |
50824425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 98 - 154
Target Start/End: Original strand, 1247246 - 1247302
Alignment:
| Q |
98 |
tttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| ||||||||||| | |||||||| |
|
|
| T |
1247246 |
tttgttgtccctgtgagcttaactcagttgataaggatattgcataatttatgcagg |
1247302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 98 - 154
Target Start/End: Original strand, 8415720 - 8415776
Alignment:
| Q |
98 |
tttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||| |||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8415720 |
tttgtcatccacgtgagcttagctcagttcgtagggatattgcatattatatgcagg |
8415776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 108 - 152
Target Start/End: Original strand, 16182199 - 16182243
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
16182199 |
ccgtgagcttagctgagttggtagagatattgcatattatatgca |
16182243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 109 - 157
Target Start/End: Complemental strand, 16313774 - 16313726
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
16313774 |
cgtgagcttaactcaattggtaggaatattgcatattatatgcaggagc |
16313726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 27344474 - 27344522
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||| |||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
27344474 |
ttatcctcgtgagcttagctcagttggtagacatattgcatattatatg |
27344522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 46021954 - 46021894
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||| || |||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
46021954 |
ttatccccgtgagcgtagctcagtaagtagggatattgcatattatatgcaggagccgggg |
46021894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 52369599 - 52369647
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||| ||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
52369599 |
cgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
52369647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 30469 - 30410
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| ||||| |||||| ||| |||||||||| |||||||||||||| |||| |
|
|
| T |
30469 |
tatccccgtgaacttaattcagttagtagggatattgcattttatatgcaggagccgggg |
30410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 109 - 160
Target Start/End: Complemental strand, 3560449 - 3560398
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
||||||||||||||||||| ||| |||||| |||||||||||||| ||||| |
|
|
| T |
3560449 |
cgtgagcttaactcagttggtagggatattatatattatatgcaggggctgg |
3560398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 7180688 - 7180637
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
7180688 |
tatccccgtgaggttagctcagttggtaggaatattgcatattatatgcagg |
7180637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 18216902 - 18216961
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||| |||||| |||||| |||| |||| |
|
|
| T |
18216902 |
tatccccgtgagcttagctcagttggtagggatattacatattttatgcaagagccgggg |
18216961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 154
Target Start/End: Complemental strand, 23369120 - 23369077
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| | ||||||| |||||||||||||| |
|
|
| T |
23369120 |
tgagcttaactcagttgatcgggatattgtatattatatgcagg |
23369077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 32557004 - 32556953
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||| |||||||||||| ||||| || ||| ||||||||||||||||||||| |
|
|
| T |
32557004 |
ttattcccgtgagcttagctcagctggtagggatattgcatattatatgcag |
32556953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 101 - 156
Target Start/End: Original strand, 32977634 - 32977689
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||| ||||| |||| |||||||| || | ||||||||||||||||||||||| |
|
|
| T |
32977634 |
gttatccacgtgaacttagctcagttggtataaatattgcatattatatgcaggag |
32977689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 108 - 151
Target Start/End: Complemental strand, 46867923 - 46867880
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
|||||| |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
46867923 |
ccgtgaacttaactcagttcatagggatattgcatattatatgc |
46867880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 154
Target Start/End: Original strand, 621586 - 621624
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
621586 |
ttaactcagttgatagggatattgcatattttatgcagg |
621624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 100 - 138
Target Start/End: Complemental strand, 9188676 - 9188638
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatatt |
138 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
9188676 |
tgttattcccgtgagcttaactcagttggtagagatatt |
9188638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 154
Target Start/End: Complemental strand, 10248490 - 10248452
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
10248490 |
ttaactcagttggtagagatattgtatattatatgcagg |
10248452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 31401315 - 31401265
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||| |||||||||||| || |||||||| | ||||||||||| |
|
|
| T |
31401315 |
cccgtgagcttagctcagttgatagggacattgcataatttatgcaggagc |
31401265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 36726561 - 36726611
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
36726561 |
cccgtgagtttagctcagttgataggaatattgtatattatatgcaggagc |
36726611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 154
Target Start/End: Original strand, 40634210 - 40634248
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
40634210 |
ttaactcagttggtagggatattgcatattatatgcagg |
40634248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 45333784 - 45333727
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||| |||||||||| ||||||| |
|
|
| T |
45333784 |
atccccgtgagcttagctcagttggcagggatattgcata-tatatgcaggggctgggg |
45333727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 157
Target Start/End: Complemental strand, 46161189 - 46161143
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
46161189 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggagc |
46161143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 142
Target Start/End: Original strand, 46966364 - 46966401
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46966364 |
atccccgtgagcttaactcagttgatag-gatattgcat |
46966401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Complemental strand, 47930728 - 47930686
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
47930728 |
ctcagttggtagggatattgcatattatatgcaggggctgggg |
47930686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 150
Target Start/End: Complemental strand, 10699247 - 10699210
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
10699247 |
agcttaactcagttgttagagatattacatattatatg |
10699210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 14349646 - 14349687
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
14349646 |
cgtgaacttagctcagttggtagagatattgcatattatatg |
14349687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 14519316 - 14519369
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||| ||||| ||| |||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
14519316 |
tatcccggtgagtttatctcagttgatagggatattccatattatattcaggag |
14519369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 19924428 - 19924492
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||| |||| ||||||||| ||| | |||||||||| |
|
|
| T |
19924428 |
atccccgtgatcttaactcagttggtagggatatcgcattttatatgcaagag-tcggggttcgaa |
19924492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 32970872 - 32970823
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||| || |||||||||||| |||||||||| ||||||||||| |
|
|
| T |
32970872 |
tccccgtaagcgtagctcagttgatagggatattgcattttatatgcagg |
32970823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 40520289 - 40520330
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||| |||| ||||||||||||||||||||| |
|
|
| T |
40520289 |
agcttaactcatttgctagaaatattgcatattatatgcagg |
40520330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 42299581 - 42299536
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
42299581 |
cgtgagcttagttcagttggtagggatattgcatattatatgcagg |
42299536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 3694982 - 3694930
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||| |||||| |||| |
|
|
| T |
3694982 |
gtgagcttagctcagttggaagggatattgcatattatatgtaggagccgggg |
3694930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 154
Target Start/End: Original strand, 8780775 - 8780815
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
8780775 |
gcttaactcagttggtacggatattgcatattatatgcagg |
8780815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 12404351 - 12404403
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||| ||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
12404351 |
ttatccccgtgagattagatcaattggtagggatattgcatattatatgcagg |
12404403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 146
Target Start/End: Original strand, 18101446 - 18101490
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatatta |
146 |
Q |
| |
|
|||||||||||| |||| |||||||| |||||||||| ||||||| |
|
|
| T |
18101446 |
ttatccccgtgatcttatctcagttggtagagatattacatatta |
18101490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 27579545 - 27579497
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| ||||||||||||| || |||||| ||||||||||||||| |
|
|
| T |
27579545 |
ccccgtgaacttaactcagttggtatggatattacatattatatgcagg |
27579497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 179
Target Start/End: Complemental strand, 28564415 - 28564344
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||| |||||||||||||| ||| ||||||||| |||||||||||| | | |||||||||| |||| |||| |
|
|
| T |
28564415 |
cccgtaagcttaactcagttagtagggatattgcagattatatgcagg-ggttggggttcgaacctcggacac |
28564344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 153
Target Start/End: Complemental strand, 33843259 - 33843219
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
33843259 |
agcttagctcagttgatagagatattgcataatttatgcag |
33843219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 153
Target Start/End: Original strand, 33950720 - 33950760
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | ||||||| |
|
|
| T |
33950720 |
agcttagctcagttgatagagatattgcataatttatgcag |
33950760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 36754350 - 36754394
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| ||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
36754350 |
gtgagcttagctcagttgacatagatactgcatattatatgcagg |
36754394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 37626232 - 37626180
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||| || ||||||||||| |
|
|
| T |
37626232 |
ttatccccgtgagcttacctcagttggtagggatattatattttatatgcagg |
37626180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 39347053 - 39346994
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| || ||||| ||| ||||||||| |||||||||||||| |||| |
|
|
| T |
39347053 |
ttatccccgtgagcttagcttagttggtagt-atattgcattttatatgcaggagccgggg |
39346994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 46225390 - 46225434
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
46225390 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
46225434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 154
Target Start/End: Original strand, 49253609 - 49253656
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
49253609 |
ccccgtgagcttagctaagttggtag-gatattgcatattatatgcagg |
49253656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 111 - 155
Target Start/End: Original strand, 51933510 - 51933554
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
|||||||| |||| ||| ||| ||||||||||||||||||||||| |
|
|
| T |
51933510 |
tgagcttagctcaattggtagggatattgcatattatatgcagga |
51933554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 5270802 - 5270759
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| |||||||| |
|
|
| T |
5270802 |
cgtgagcttaactcagttagtagagataatgcataatatatgca |
5270759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 154
Target Start/End: Complemental strand, 6463114 - 6463059
Alignment:
| Q |
99 |
ttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||| |||||||| |||||||| ||| ||||||| || ||||||||||| |
|
|
| T |
6463114 |
ttgtaatccccatgagcttagctcagttggtagggatattgtattttatatgcagg |
6463059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 7188614 - 7188669
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||||||| || ||| |||||| ||||| |||||| ||||||| |
|
|
| T |
7188614 |
atccccgtgagcttaactcaattagtagggatatttcatataatatgccggagctg |
7188669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 115 - 154
Target Start/End: Complemental strand, 19063395 - 19063356
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
19063395 |
cttagctcagttagtagagatattgcatattatatgcagg |
19063356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 24874138 - 24874185
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||||||| || |||||||| | |||||||| |
|
|
| T |
24874138 |
cccgtgagcttagctcagttgatagggacattgcataatttatgcagg |
24874185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 106 - 149
Target Start/End: Original strand, 27818568 - 27818611
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||| |||||||| |||||||| ||| ||||||||||||||||| |
|
|
| T |
27818568 |
ccccctgagcttagctcagttggtagggatattgcatattatat |
27818611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 30734520 - 30734473
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| |||||||||||| || | ||||||||||||||||||||| |
|
|
| T |
30734520 |
cccgtgaatttaactcagttggtataaatattgcatattatatgcagg |
30734473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 31060269 - 31060226
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||| ||||| |||||||||||||||| |||||| |||||||| |
|
|
| T |
31060269 |
cgtgatcttaattcagttgatagagataatgcataatatatgca |
31060226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 102 - 149
Target Start/End: Complemental strand, 31762071 - 31762024
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||| ||||||||| |||||||| || ||||||||||||||||| |
|
|
| T |
31762071 |
ttatcccagtgagcttagctcagttggcagtgatattgcatattatat |
31762024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 31818598 - 31818649
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
31818598 |
tgagcttagttcagttgctaggaatattgcatattatatgcaggagccgggg |
31818649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 40211595 - 40211534
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||| |||||||||||||||| | |||||||||| |
|
|
| T |
40211595 |
ttatccccgtgagcttaactcagttggtag-----ttgtatattatatgcaggag-tcggggttcgaa |
40211534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 42472273 - 42472230
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||| || |||||||||| || |||||||||||||||||| |
|
|
| T |
42472273 |
cccgtgagtttgactcagttgacagggatattgcatattatatg |
42472230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 48643620 - 48643671
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||||||| | || || |||||||||||||||||||||||||| |
|
|
| T |
48643620 |
tatctccgtgagcttagtttagctggtagagatattgcatattatatgcagg |
48643671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 51942303 - 51942342
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
51942303 |
cttaactcagttggtagggatattgcatattatatacagg |
51942342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 52; Significance: 3e-21; HSPs: 118)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 33549128 - 33549069
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33549128 |
tatccccgtgagcttagctcagttgatagagatattgtatattatatgcaggagctgggg |
33549069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 5e-20
Query Start/End: Original strand, 102 - 171
Target Start/End: Complemental strand, 35798101 - 35798033
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaac |
171 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
35798101 |
ttatccccgtgagcttaactcagttgttagagatattgcatattatatgcagg-ggttggggttcgaaac |
35798033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 107 - 159
Target Start/End: Complemental strand, 9330571 - 9330519
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9330571 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggggctg |
9330519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 19281604 - 19281663
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19281604 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
19281663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 25857369 - 25857310
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
25857369 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
25857310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 19684070 - 19684128
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
19684128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 39408765 - 39408705
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||||||||||||||| |||| |||| |
|
|
| T |
39408765 |
ttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaagagccgggg |
39408705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 3446725 - 3446780
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
3446725 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
3446780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 5521294 - 5521243
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
5521294 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
5521243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 18694781 - 18694840
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
18694781 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggaactgggg |
18694840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 20296415 - 20296473
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
20296415 |
atccccgtgagcttagctcagttgataaggatattgcatattatatgcaggagccgggg |
20296473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 22653718 - 22653653
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
22653718 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
22653653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 22718134 - 22718076
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| || |||||||||||||||||||||| |
|
|
| T |
22718134 |
atccccgtgagcttaactcagttggtagggatactgtatattatatgcaggagctgggg |
22718076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 40473623 - 40473565
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
40473623 |
atccccgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggctgggg |
40473565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 4183173 - 4183237
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
4183173 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
4183237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 162
Target Start/End: Complemental strand, 4562832 - 4562767
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
4562832 |
tttttttatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
4562767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 161
Target Start/End: Original strand, 27297172 - 27297229
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggatattgcatattgtatgcaggagctggg |
27297229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 30932520 - 30932467
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
30932520 |
tatccccgtgagcttacctcagttggtagggatattgcatattatatgcaggag |
30932467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 2643692 - 2643752
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2643692 |
ttatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagccgggg |
2643752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 6331552 - 6331612
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||| |||||||||||||| || |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
6331552 |
ttttattatccccgtgagcatagctcagttggtagggatattgcatattatatgcaggagc |
6331612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 11050832 - 11050772
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
11050832 |
ttatccccgtgagcttagctcagttggtagggatattacatattatatgcaggggctgggg |
11050772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 33233295 - 33233243
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
33233295 |
atccccgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
33233243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 36005437 - 36005497
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||| ||||||| ||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
36005437 |
ttatccccgtgagcgtaactcaattggtagggatattgcatattatatgcaggagccgggg |
36005497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 8250375 - 8250324
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8250375 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8250324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 17034730 - 17034796
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||| |||| ||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
17034730 |
ttatccccgtgagcttagctcaattggtagggatattgcatattatatgcaggag-tcggggttcgaa |
17034796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 17078452 - 17078518
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
17078452 |
ttatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggag-tcggggttcgaa |
17078518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 33229007 - 33228956
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33229007 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
33228956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 44948592 - 44948643
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
44948592 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44948643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 169
Target Start/End: Original strand, 3438944 - 3439009
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||| || |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
3438944 |
tatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
3439009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 18278490 - 18278432
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
18278490 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
18278432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 32609261 - 32609196
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||||||||||||| ||| | |||||||||| |
|
|
| T |
32609261 |
tatctccgtgagcttaactcagttggtagggatattgcatattatatgcaagag-tcggggttcgaa |
32609196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 33041938 - 33041888
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
33041938 |
ttatccccgtgagtttaactcagttggtagggatattgcatattatatgca |
33041888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 38400307 - 38400357
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
38400357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 41509517 - 41509571
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
41509571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 149
Target Start/End: Original strand, 5062294 - 5062339
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
5062294 |
atccccgtgagcttaactcagttggtagggatattgcatattatat |
5062339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 7379673 - 7379624
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
7379673 |
atccccgtgagcttaactcagttggtaaggatattgcatattatatgcag |
7379624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 36182644 - 36182697
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
36182644 |
cgtgagcttagctcagttggtagggatattgcatattatatgcaggagcagggg |
36182697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 5474901 - 5474961
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| || |||||||||||||||| |||||||| |||| |
|
|
| T |
5474901 |
ttatccccgtgagcttagctcagttggcagggatattgcatattatacgcaggagccgggg |
5474961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 28153216 - 28153164
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
|||||| |||||||||||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
28153216 |
tatcccagtgagcttaactcagttggtagggatattgcatgttatatgcagga |
28153164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 28194629 - 28194685
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
|||||| |||||||| |||||||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
28194629 |
atccccatgagcttagctcagttgctagggatattgcatattatatgcaggggctgg |
28194685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 33669731 - 33669779
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33669731 |
ttatccccgtgagcttaactcagttagtagggatattgcatattatatg |
33669779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 33816491 - 33816439
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| || ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
33816491 |
ttatccccgtcagtttacctcagttggtagagatattgcatattatatgcagg |
33816439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 106 - 154
Target Start/End: Original strand, 34613978 - 34614026
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
34614026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 44822418 - 44822478
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||| |||| |||||||||||||| |||| |
|
|
| T |
44822418 |
ttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccgggg |
44822478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 1071466 - 1071525
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
1071466 |
tatccccgtgagcttagctcagttggtatggatattgtatattatatgcaggagccgggg |
1071525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 179
Target Start/End: Original strand, 1844814 - 1844888
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||| |||||| |||||||| ||| |||||||||||||||||||||| || |||||||||| |||| |||| |
|
|
| T |
1844814 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggc-cggggttcgaacctcggacac |
1844888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 2289606 - 2289657
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
2289606 |
tatccccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
2289657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 8742894 - 8742839
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| |||||||||| ||||||||||| ||| ||||||| |
|
|
| T |
8742894 |
cccgtgagcttagctcagttggtagagatattacatattatatgtaggggctgggg |
8742839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 15485658 - 15485717
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||||| ||||| |||| |
|
|
| T |
15485658 |
tatccccgtgagcttagctcagttggtaaggatattgcatattatatgctggagcagggg |
15485717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 19612715 - 19612770
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
19612715 |
cccgtgagcttagttcagttggtagggatattgcatattatatgtaggagctgggg |
19612770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 38557297 - 38557246
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
38557297 |
tatccccgtgagcttaactcagttggtagggatatggcattttatatgcagg |
38557246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 40535523 - 40535472
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
40535523 |
tatccccgtgagcttagctcagttggtacggatattgcatattatatgcagg |
40535472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 12747739 - 12747793
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||||| ||| || ||||| |
|
|
| T |
12747739 |
ccgtgagcttaactcagttggtagaaatattgcatattatatacagaagttgggg |
12747793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 15233410 - 15233460
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
15233410 |
atccccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
15233460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 15764927 - 15764977
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15764927 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15764977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 24581537 - 24581479
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||||||||||||||| || ||||||||||| |||||||||| ||||||| |
|
|
| T |
24581537 |
atccccgtaagcttaactcagttggcagggatattgcataatatatgcaggggctgggg |
24581479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 152
Target Start/End: Original strand, 25076762 - 25076812
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||| |||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
25076762 |
ttatccccgcgagcttaactcagttggtaaagatattgcattttatatgca |
25076812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 40363140 - 40363098
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
40363140 |
ccgtgagcttaactcagttggtagggatattgcatattatatg |
40363098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 41187261 - 41187315
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||| |||| ||||| |
|
|
| T |
41187261 |
ccgtgagcttaactcagttggtagaaatattacatattatatgctggagttgggg |
41187315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 96 - 154
Target Start/End: Original strand, 43146341 - 43146399
Alignment:
| Q |
96 |
gttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| ||| ||||||||||| | |||||||| |
|
|
| T |
43146341 |
gttttattatccccgtgagtttaactcagttggtagggatattgcataatttatgcagg |
43146399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 44857307 - 44857257
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
44857307 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
44857257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 14215872 - 14215937
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||||||||||||| ||| |||||| ||||| |||| ||||||||||||||||||| |
|
|
| T |
14215872 |
ttttattatccccgtgagcttagatcaaatgatagggatatcgcatgttatatgcaggagctgggg |
14215937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 154
Target Start/End: Original strand, 17601069 - 17601126
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||| |||||| ||||||||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
17601069 |
tttttttatctccgtgaacttaactcagttggtagggatattgcatatcatatgcagg |
17601126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 34434462 - 34434417
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
34434462 |
cgtgagcttaacttagttgatagggatattgtatattatatgcagg |
34434417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 179
Target Start/End: Complemental strand, 38179320 - 38179244
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||| ||||| ||| |||||||| ||| |||||||||| ||||||||||| ||| |||||||||| |||| |||| |
|
|
| T |
38179320 |
ttatccctgtgagtttagctcagttggtagggatattgcattttatatgcaggggct-ggggttcgaacctcggacac |
38179244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 41566760 - 41566809
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
41566760 |
tccccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
41566809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 103 - 171
Target Start/End: Complemental strand, 466680 - 466613
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaac |
171 |
Q |
| |
|
||||||||||||| || |||||||| ||| |||||| ||||||||||||| ||| | |||||||||||| |
|
|
| T |
466680 |
tatccccgtgagcatagctcagttggtagggatattacatattatatgcaagag-tcggggttcgaaac |
466613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 130 - 162
Target Start/End: Complemental strand, 1309173 - 1309141
Alignment:
| Q |
130 |
agagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1309173 |
agagatattgcatattatatgcaggagctgggg |
1309141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 6636034 - 6635990
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcatattatatgcagg |
6635990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 18803206 - 18803266
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||| ||| ||| ||||||||||||||||||| |||| |||| |
|
|
| T |
18803206 |
ttatccccgtgagcttagctcacttggtaggaatattgcatattatatgcaagagccgggg |
18803266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 28195207 - 28195159
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
28195207 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgca |
28195159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 30390444 - 30390384
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
30390444 |
ttatacccgtgaatttagctcagttggtagggatattgcatattatatgcaggagccgggg |
30390384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 150
Target Start/End: Original strand, 32168931 - 32168971
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
32168931 |
gtgagcttaactcagttggtagggatattgcatattatatg |
32168971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 37352560 - 37352516
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
37352560 |
gtgagtttaactcagttggtagggatattgcatattatatgcagg |
37352516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 103 - 155
Target Start/End: Original strand, 44021070 - 44021122
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||| |||||| ||||| |
|
|
| T |
44021070 |
tatccccgtgagcttaactcagttggtaggaatattgcatgttatatacagga |
44021122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 44898556 - 44898504
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
||||| |||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
44898556 |
tatcctcgtgaggttaactcagttggtaggaatattgcatattatatgcagga |
44898504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 155
Target Start/End: Original strand, 1260182 - 1260233
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| ||||||| |||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgtagga |
1260233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 27913539 - 27913492
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
27913539 |
cccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
27913492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 153
Target Start/End: Complemental strand, 29942193 - 29942150
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29942193 |
gtgagcttaactcagttagtagggatattgcatattatatgcag |
29942150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 31223624 - 31223675
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
31223624 |
tgagcttagttcagttggtagggatattgcatattatatgcaggggctgggg |
31223675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 35367406 - 35367453
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||| |||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
35367406 |
ttatccccatgagcttagctcagttgataatgatattgcatattatat |
35367453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Original strand, 1500974 - 1501016
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
1500974 |
ctcagttggtagggatattgcatattatatgcaggggctgggg |
1501016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 3287129 - 3287079
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
3287129 |
atccctgtgagcttagctcagttggaagggatattgcatattatatgcagg |
3287079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 169
Target Start/End: Complemental strand, 11093858 - 11093797
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||| || ||| ||||| |||||||||||||||||| | |||||||||| |
|
|
| T |
11093858 |
cccgtgagcttaactcatttagtagggatatcgcatattatatgcaggag-tcggggttcgaa |
11093797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 17487705 - 17487759
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| |||| |||||||| ||| ||||||||||||||||||||| ||||||| |
|
|
| T |
17487705 |
ccgtgaacttagctcagttggtagggatattgcatattatatgcagtggctgggg |
17487759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 150
Target Start/End: Complemental strand, 18559274 - 18559240
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
18559274 |
ttaactcagttgatagggatattgcatattatatg |
18559240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 27497603 - 27497553
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||| || |||||||| ||| |||||||||| ||||||||| |
|
|
| T |
27497603 |
ttatccccgtgagcatagctcagttggtagggatattgcatgttatatgca |
27497553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 29772347 - 29772305
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
29772347 |
ccgtgagcttaacacagttggtagggatattgcatattatatg |
29772305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 169
Target Start/End: Complemental strand, 30392898 - 30392841
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgtaggag-tcggggttcgaa |
30392841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 33563282 - 33563232
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||||| || ||||||||||| |
|
|
| T |
33563282 |
atccccgtgaacttaactcagttggtagggatattgtattttatatgcagg |
33563232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 38525626 - 38525576
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||| ||||||||||| |
|
|
| T |
38525626 |
atccccgtgagcttagctcagttggtaaggatattgcattttatatgcagg |
38525576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 40688712 - 40688662
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||| |||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
40688712 |
atcctcgtgatcttagctcagttggtagagatattgcattttatatgcagg |
40688662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 105 - 143
Target Start/End: Original strand, 43214354 - 43214392
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcata |
143 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
43214354 |
tccccgtgagcttaactcagttggtagggatattgcata |
43214392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 5168639 - 5168598
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||||||||||||| |||| |||||| |||||||| |
|
|
| T |
5168639 |
tgagcttaactcagttgatagggataatgcataatatatgca |
5168598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 7661468 - 7661419
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||| |||| |||||||||| |||||||| | |||||||||| |
|
|
| T |
7661468 |
cccgtgagcttagctcacttgatagagacattgcataatttatgcaggag |
7661419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 166
Target Start/End: Complemental strand, 22358087 - 22358030
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttc |
166 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||| |||||||| || | |||||||| |
|
|
| T |
22358087 |
cgtgagcttaactcagttgataaaaataatgcatagtatatgcaagatcagggggttc |
22358030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 23405194 - 23405243
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| |||||||| ||| || |||||||| |||||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
23405243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Original strand, 27359623 - 27359671
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||| |||||| ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
27359623 |
atccccgtaagctta-ctcggttgatagagatattgcatgttatatgcag |
27359671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 35429674 - 35429625
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| |||||||| |||||| |||||||| | |||||||| |
|
|
| T |
35429674 |
tccccgtgagcttagctcagttggtagagacattgcataatttatgcagg |
35429625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 121 - 162
Target Start/End: Original strand, 38387677 - 38387718
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
38387677 |
tcagttggtagggatattgcatattatatgcaggggctgggg |
38387718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 106 - 159
Target Start/End: Original strand, 44658329 - 44658382
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||||||| ||||||| ||| ||||||||||||||||||||| |||| |
|
|
| T |
44658329 |
ccccgtgagcttagctcagttagtaggaatattgcatattatatgcaggggctg |
44658382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 1232187 - 1232239
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||| ||| ||||||||||| |
|
|
| T |
1232187 |
ttatccccgtgagcttaactcagttggtaaggatatcacattttatatgcagg |
1232239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 2806576 - 2806528
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||||||| |||||||||| |
|
|
| T |
2806576 |
ttattcccgtgagcttagctcagttggtagggatattgtatattatatg |
2806528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 5003703 - 5003659
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
5003703 |
gtgagcttgactcagttggtagggatattgcattttatatgcagg |
5003659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 5112925 - 5112874
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||||||||| ||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
5112925 |
ttattcccgtgagcttaattcagttggtag-gatattgcatatgatatgcagg |
5112874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 103 - 147
Target Start/End: Complemental strand, 11144288 - 11144244
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattat |
147 |
Q |
| |
|
|||||||||||| ||| |||||||| |||| |||||||||||||| |
|
|
| T |
11144288 |
tatccccgtgagtttagctcagttggtagaaatattgcatattat |
11144244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 20239337 - 20239385
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| ||||||||||||||| ||||||| |||| |||||| |||||||| |
|
|
| T |
20239337 |
atccgcgtgagcttaactcaattgatagggataatgcataatatatgca |
20239385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 33222221 - 33222181
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
33222221 |
gtgaacttaactcagttggtagggatattgcatattatatg |
33222181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 145
Target Start/End: Original strand, 34388633 - 34388669
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatatt |
145 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
34388633 |
cgtgagtttaactcagttgatagagatagtgcatatt |
34388669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 37063523 - 37063567
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
37063523 |
gtgatcttacctcagttggtagggatattgcatattatatgcagg |
37063567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 150
Target Start/End: Original strand, 40931139 - 40931179
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40931139 |
gtgagcttaactcatttggcagagatattgcatattatatg |
40931179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 116 - 156
Target Start/End: Complemental strand, 45241140 - 45241100
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||| ||||| |
|
|
| T |
45241140 |
ttaactcagttgacagagatgttgcatattatatgtaggag |
45241100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 14835285 - 14835328
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
14835285 |
tgagtttagctcagttgatagtgatattgtatattatatgcagg |
14835328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 144
Target Start/End: Complemental strand, 19208971 - 19208932
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatat |
144 |
Q |
| |
|
|||||||||||| |||||||||||||| || ||||||||| |
|
|
| T |
19208971 |
tccccgtgagctaaactcagttgatagggacattgcatat |
19208932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 20528245 - 20528202
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||| || |||||||||||||||||| |||| ||||||| |
|
|
| T |
20528245 |
cccgtgagcgtagctcagttgatagagatatcgcatgttatatg |
20528202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 22589903 - 22589946
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
22589903 |
tgagcttatcttagttggtagggatattgcatattatatgcagg |
22589946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 43936697 - 43936748
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
43936697 |
tatctccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
43936748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 119 - 150
Target Start/End: Complemental strand, 45407466 - 45407435
Alignment:
| Q |
119 |
actcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
45407466 |
actcggttgatagagatattgcatattatatg |
45407435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 51; Significance: 1e-20; HSPs: 89)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 100 - 162
Target Start/End: Original strand, 31802046 - 31802108
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31802046 |
tgttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
31802108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 17454819 - 17454754
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
17454819 |
tatccccgtgagcttatctcagttggtagagatattgcatattatatgcaggag-tcggggttcgaa |
17454754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 33573807 - 33573872
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
33573807 |
tttttttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
33573872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 28237327 - 28237267
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
28237327 |
ttatcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
28237267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 6419156 - 6419105
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6419156 |
tatccccgtgagtttaactcagttggtagagatattgcatattatatgcagg |
6419105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 9435622 - 9435681
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
9435622 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
9435681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 10934595 - 10934654
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10934595 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
10934654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 4408355 - 4408413
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
4408355 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
4408413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 7207841 - 7207899
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
7207899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 9246457 - 9246403
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9246457 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
9246403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 17441912 - 17441854
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
17441912 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
17441854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 19953901 - 19953843
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
19953901 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
19953843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 27094880 - 27094830
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
27094880 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
27094830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 33697186 - 33697136
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
33697186 |
atccccgtgagcttaactcagttgatagggatattgcattttatatgcagg |
33697136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 6210044 - 6210109
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||||||||| |||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
6210044 |
tttttttatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggggctgggg |
6210109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 20584070 - 20584123
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
20584070 |
atccctgtgagcttaactcagttgatagcgatattgcatattatatacaggagc |
20584123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 3794246 - 3794194
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
3794194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 7865430 - 7865378
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7865430 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7865378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 13732809 - 13732857
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
13732809 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgca |
13732857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 110 - 157
Target Start/End: Original strand, 361166 - 361213
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
361166 |
gtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
361213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 7545325 - 7545376
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7545325 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
7545376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 9704412 - 9704467
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||| |||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
9704412 |
ttatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagc |
9704467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 15091444 - 15091495
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15091444 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15091495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 30885644 - 30885585
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
30885644 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatacaggggctgggg |
30885585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 32050035 - 32049980
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||| || ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32050035 |
cccgtgagcttaactcagctggtagggatattgcatattatatgcaggagccgggg |
32049980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 9372274 - 9372224
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9372224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 1968991 - 1969043
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
1968991 |
ttatccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
1969043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 7177290 - 7177350
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||| || ||||||||||| ||||||| |
|
|
| T |
7177290 |
ttatccccgtgagcttagctcagttggtagggatattgtattttatatgcaggggctgggg |
7177350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 607184 - 607231
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgc |
607231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 8439675 - 8439722
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8439722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 28030860 - 28030911
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| ||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
28030860 |
tatccctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
28030911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 31104878 - 31104929
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||| ||||||||||||||| |
|
|
| T |
31104878 |
tatccccgtgagcttagttcagttgatagggatattacatattatatgcagg |
31104929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 32611620 - 32611569
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32611620 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
32611569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 3294765 - 3294811
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
3294811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 4661093 - 4661143
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
4661093 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
4661143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 8857087 - 8857137
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
8857087 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcagg |
8857137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 12284122 - 12284168
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
12284122 |
ccgtgagcttaactcagttggtagggatattgaatattatatgcagg |
12284168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 27218884 - 27218934
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||| |||| |||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
27218884 |
cccgtgaccttagctcagttgatagggatattgcatattatatgtaggagc |
27218934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 28222863 - 28222909
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
28222863 |
cccgtgaacttaactcagttggtagggatattgcatattatatgcag |
28222909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 152
Target Start/End: Complemental strand, 12078 - 12029
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| |||||| |||||||| |
|
|
| T |
12078 |
tatccccgtgagtttagctcagttgatagagataatgcataatatatgca |
12029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 743565 - 743618
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||| |||||||||| |||| |
|
|
| T |
743565 |
cgtgagcttagctcagttggtagggatattgcatattagatgcaggagccgggg |
743618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 7418280 - 7418325
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
7418280 |
cgtgagcttaactcatttggtagggatattgcatattatatgcagg |
7418325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 28148806 - 28148753
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||| ||| |||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
28148806 |
atccccttgaacttagctcagttggtagggatattgcatattatatgcaggagc |
28148753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 156
Target Start/End: Complemental strand, 30700257 - 30700212
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
30700257 |
tgagcttaactcagttggtacggatattgcatattatatgcaggag |
30700212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 106 - 154
Target Start/End: Original strand, 2251837 - 2251885
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggatattgcatactatatgcagg |
2251885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 10483611 - 10483559
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
10483611 |
ttatccccgtgatcttagctcagttggtagggatattgcattttatatgcagg |
10483559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 111 - 179
Target Start/End: Original strand, 11301371 - 11301438
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||| || |||||||||||| ||||||||||||||||||||||| | |||||||||| |||| |||| |
|
|
| T |
11301371 |
tgagcatagctcagttgataggaatattgcatattatatgcaggag-ttggggttcgaatctcggacac |
11301438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 109 - 149
Target Start/End: Original strand, 14552336 - 14552376
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
14552336 |
cgtgagcttaactcagttgatagagataatgcataatatat |
14552376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 19374915 - 19374863
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
19374915 |
ttatccccgtgagcttagctcagttagtaggaatattgcatattatatgcagg |
19374863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 26557379 - 26557331
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||| | |||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
26557379 |
atccccgtaaacttagctcagttgattgagatattgcatattatatgca |
26557331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 32166364 - 32166416
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||| |||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
32166364 |
ttattcccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
32166416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 100 - 179
Target Start/End: Original strand, 216199 - 216277
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||| ||||||||| |||| ||| ||| |||||||||| ||||||||||| || |||||||||| |||| |||| |
|
|
| T |
216199 |
tgttatcccagtgagcttagctcaattggtagggatattgcatgttatatgcagggtct-ggggttcgaacctcggacac |
216277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 4869768 - 4869721
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| |||| ||||||||||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggatactgcatattatatgcagg |
4869721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 114 - 169
Target Start/End: Original strand, 7072085 - 7072139
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
7072085 |
gcttaactcagttggtagggatattacatattatatgcaggag-tcggggttcgaa |
7072139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 7153792 - 7153835
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
7153792 |
tgagcttaactcagttggtagggatattgcatgttatatgcagg |
7153835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 10517195 - 10517246
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||| ||||||||||| |
|
|
| T |
10517195 |
tatccccgtgagcttagctcagttggtatggatattgcattttatatgcagg |
10517246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 120 - 155
Target Start/End: Original strand, 13698605 - 13698640
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
13698605 |
ctcaattgatagagatattgcatattatatgcagga |
13698640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 15964009 - 15963958
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcaggggctgggg |
15963958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 22574866 - 22574917
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
22574866 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
22574917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 24758735 - 24758786
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||| |||| ||||||||||| |
|
|
| T |
24758735 |
tatccccgtgagcttaactcaattggtagggatatcgcattttatatgcagg |
24758786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 171
Target Start/End: Original strand, 29733625 - 29733692
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaac |
171 |
Q |
| |
|
|||||||||| |||| |||||||| || |||||| ||||||||||||||| || |||||||||||| |
|
|
| T |
29733625 |
atccccgtgaacttagctcagttggtacggatattacatattatatgcaggggcccggggttcgaaac |
29733692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 33140407 - 33140453
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
33140407 |
cccgtgagcttaattcagttgatag-gatattgcatgttatatgcagg |
33140453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 978207 - 978157
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
978207 |
atccccgtgagtttagctcagttagtagggatattgcatattatatgcagg |
978157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 1435806 - 1435856
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||||||||||||| | ||| |||||| ||||||||||||||| |
|
|
| T |
1435806 |
atcctcgtgagcttaactcagtaggtagggatattacatattatatgcagg |
1435856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Complemental strand, 3795831 - 3795789
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
3795831 |
ctcagttggtagggatattgcatattatatgcaggggctgggg |
3795789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 7328716 - 7328670
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| |||||| |||| |
|
|
| T |
7328716 |
ccgtgagcttaactcagttggtagggatattgcattttatatccagg |
7328670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 9888600 - 9888546
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||| |||||| |||||||||||| ||| ||||||| ||||| |||||||||| |
|
|
| T |
9888600 |
ttatcctcgtgagtttaactcagttggtagggatattgtatattctatgcaggag |
9888546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 19892349 - 19892303
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
19892349 |
atccccgtgagcttagttcagttggtagggatattgcatattatatg |
19892303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 29284263 - 29284309
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||| ||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
29284263 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
29284309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 32813723 - 32813673
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
32813723 |
atccccgtgagcttagttcagttggtacggatattgcatattatatgcagg |
32813673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 150
Target Start/End: Complemental strand, 34181577 - 34181535
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||| |
|
|
| T |
34181577 |
ccgtgagtttaactcagttgataacgatattgcatattatatg |
34181535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 153
Target Start/End: Complemental strand, 34432867 - 34432821
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34432867 |
cccgtgagcttagttcagttggtagggatattgcatattatatgcag |
34432821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 150
Target Start/End: Original strand, 20728957 - 20728994
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20728957 |
agcttaactcagttagtagagatattgcatattatatg |
20728994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 30938390 - 30938435
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| ||| || |||||||| |||||||||| |
|
|
| T |
30938390 |
cgtgagcttaactcagttggtagggacattgcataatatatgcagg |
30938435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 32388224 - 32388273
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||||||||||||||| || |||||||| | |||||||| |
|
|
| T |
32388224 |
tccccgtaagcttaactcagttgatagggacattgcataatttatgcagg |
32388273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 3640511 - 3640559
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| |||||||||| |||||||| ||| ||||||||||| |||||||| |
|
|
| T |
3640511 |
atcctcgtgagcttagctcagttggtagggatattgcatagtatatgca |
3640559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 5052146 - 5052094
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||| |||| ||| ||| ||||| |||| ||||||||||||| |
|
|
| T |
5052146 |
atccccgtgagcttagctcaattggtagggatatcgcattttatatgcaggag |
5052094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 160
Target Start/End: Original strand, 10628615 - 10628667
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
||||||| ||| ||| |||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
10628615 |
ccgtgagtttagctcggttggtagggatattgcatattatatgcaggggctgg |
10628667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 162
Target Start/End: Original strand, 15285546 - 15285598
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||| |||||||||||| ||| |||||| ||||||||||||| |||| |||| |
|
|
| T |
15285546 |
gtgagtttaactcagttggtagggatattacatattatatgcatgagccgggg |
15285598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 16268208 - 16268157
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||||||||| |||| ||| |||||||||| ||||||||||| |
|
|
| T |
16268208 |
ttatctccgtgagcttaactcggttggtag-gatattgcattttatatgcagg |
16268157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 98 - 150
Target Start/End: Original strand, 21203029 - 21203081
Alignment:
| Q |
98 |
tttgttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||| |||||||| ||| |||||||| ||| |||||||||||| ||||| |
|
|
| T |
21203029 |
tttgttatacccgtgagtttagctcagttggtagggatattgcatatcatatg |
21203081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 26347403 - 26347447
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||| |||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
26347403 |
ccccgtgaacttagctcagttggtagagatattgtatattatatg |
26347447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 31935102 - 31935146
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcattttatatgcagg |
31935146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 331948 - 331905
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||||||||||| |||||| | |||||| |||||||| |
|
|
| T |
331948 |
cgtgagcttaactcagttggtagagacaatgcataatatatgca |
331905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 2816887 - 2816942
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||| |||||||| |||| ||| ||| |||||||||| ||||||||||| |||| |
|
|
| T |
2816887 |
atccccatgagcttagctcaattggtagggatattgcatgttatatgcaggggctg |
2816942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 7414331 - 7414374
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
7414331 |
cgtgagcttggctcagttggtagggatattgcatattatatgca |
7414374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 115 - 150
Target Start/End: Original strand, 8374404 - 8374439
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
8374404 |
cttaactcagttggtagagatattgcataatatatg |
8374439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 10913405 - 10913456
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagata-ttgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| || |||||||| ||||||||||||| |||| |
|
|
| T |
10913405 |
atccccgtgagcttaactcaactggtagagatatttgcatattatatacagg |
10913456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 16404020 - 16403977
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
16404020 |
cgtgagcttaactcagttggcagagataatgcataatatatgca |
16403977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 1e-20; HSPs: 146)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 97 - 179
Target Start/End: Complemental strand, 4234365 - 4234284
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
4234365 |
ttttattatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggagc-cggggttcgaacctcggacac |
4234284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 26919543 - 26919483
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
26919543 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
26919483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 9761112 - 9761170
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9761112 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagctgggg |
9761170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 10402438 - 10402488
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10402438 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcagg |
10402488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 35207225 - 35207172
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35207225 |
tatctccgtgagcttaactcagttgatagggatattgcatattatatgcaggag |
35207172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 48569252 - 48569191
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
48569252 |
gttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
48569191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 53572396 - 53572347
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
53572396 |
ccgtgagcttaactcagttgatagggatattgcatattatatgcaggagc |
53572347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 46775105 - 46775045
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
46775105 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
46775045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 11375963 - 11375912
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
11375963 |
tatccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
11375912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 26868344 - 26868399
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
26868344 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
26868399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 43596891 - 43596950
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43596891 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
43596950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 55853182 - 55853131
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
55853182 |
tatccccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
55853131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 1458091 - 1458033
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
1458091 |
atccccgtaagcttagctcagttgatagggatattgcatattatatgcaggagccgggg |
1458033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 3036128 - 3036078
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3036128 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
3036078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 3847678 - 3847736
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
3847736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 6371111 - 6371169
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
6371169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 19594230 - 19594276
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19594230 |
atcctcgtgagcttaactcagttgatagagatattgcatattatatg |
19594276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 23705226 - 23705168
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||| ||||||||||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagctgggg |
23705168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 37935858 - 37935916
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
37935916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 43147457 - 43147399
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43147457 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
43147399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 158
Target Start/End: Original strand, 43207666 - 43207720
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagct |
158 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
43207666 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagct |
43207720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 45112184 - 45112126
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
45112184 |
atccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagccgggg |
45112126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 46105532 - 46105590
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
46105532 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
46105590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 103 - 153
Target Start/End: Original strand, 52798274 - 52798324
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
52798274 |
tatccccgtgagcttaactcagttggtagggatattgcatattatatgcag |
52798324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 55251424 - 55251366
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
55251366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 105 - 162
Target Start/End: Original strand, 37251111 - 37251168
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
37251111 |
tccccgtgagcttaactcagttggtagggatattgcatattttatgcaggagccgggg |
37251168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 5165852 - 5165904
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
5165852 |
ttatccccgtgagcttaactcagttggtagggatatcgcatattatatgcagg |
5165904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 7686337 - 7686285
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
7686337 |
ttatccccgtgagcttagctcagttggtagagatattgcattttatatgcagg |
7686285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 97 - 157
Target Start/End: Complemental strand, 23787419 - 23787359
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||| ||||||| |||||| ||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
23787419 |
tttttttatccctgtgagcataactcagttggtagggatattgcatattatatgcaggagc |
23787359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 39023170 - 39023222
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
39023170 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
39023222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 103 - 159
Target Start/End: Original strand, 45126128 - 45126184
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
45126128 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagctg |
45126184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 3815060 - 3815115
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| || ||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
3815060 |
cccgtgagcttagcttagttggtagggatattgcatattatatgcaggagctgggg |
3815115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 12167691 - 12167624
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||| |||| ||||||||||||| ||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
12167691 |
ttatccctgtgaacttaactcagttggtagggatattgcatattatatgcaggaggccggggttcgaa |
12167624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 22230504 - 22230449
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
22230449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 24680159 - 24680104
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctg |
24680104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 39697932 - 39697885
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
39697932 |
cccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
39697885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 42231512 - 42231567
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
42231512 |
cccgtgagcttaactcagttggtaggaatattgcatattatatgcaggagccgggg |
42231567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 47890691 - 47890742
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| | |||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47890691 |
tatccccgtgagttaaactcagttggtagagatattgcatattatatgcagg |
47890742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 49901478 - 49901529
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
49901478 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
49901529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 162
Target Start/End: Complemental strand, 542883 - 542829
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||| |||||||| ||||||| |
|
|
| T |
542883 |
ccgtgagcttagctcagttgatagggatattgcatattgtatgcaggggctgggg |
542829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 3764081 - 3764023
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggatattacatattatatgcaggggctgggg |
3764023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 5179955 - 5179897
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
5179955 |
atccccgtgaacttaactcagttggtaaggatattgcatattatatgcaggagccgggg |
5179897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 8433696 - 8433642
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagct |
158 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||| |||||||| |
|
|
| T |
8433696 |
atccccgtgagcttagctcagttggtagggatattgcatattatatccaggagct |
8433642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 8965091 - 8965141
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8965091 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8965141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 13578534 - 13578488
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
13578488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 25235870 - 25235812
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| || ||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
25235870 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggggctgggg |
25235812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 45673649 - 45673699
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
45673649 |
atccccgtgagcttaactcagttggtaggaatattgcatattatatgcagg |
45673699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 54103637 - 54103587
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| | |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54103637 |
atccccgtgcgtttaactcagttgatagggatattgcatattatatgcagg |
54103587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 4958629 - 4958565
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
4958629 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
4958565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 45849043 - 45849100
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||| |||||||| ||||| |
|
|
| T |
45849043 |
tatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggggctgg |
45849100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 55536377 - 55536430
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
55536377 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggagc |
55536430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 12504716 - 12504664
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
12504716 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
12504664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 109 - 157
Target Start/End: Original strand, 20203428 - 20203476
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
20203428 |
cgtgagcttagctcatttggtagagatattgcatattatatgcaggagc |
20203476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 22788749 - 22788697
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
22788749 |
ttattcccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
22788697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 150
Target Start/End: Complemental strand, 921553 - 921506
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
921553 |
tatccccgcgagcttagctcagttgatagagataatgcatattatatg |
921506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 27362903 - 27362852
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
27362903 |
tatctccgtgagcttaactcagttggtagcgatattacatattatatgcagg |
27362852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 40994173 - 40994118
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggatattgcatattatatgtaggagttgggg |
40994118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 43978008 - 43978055
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
43978055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 48615542 - 48615487
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||||||||||||||| ||| |||| |
|
|
| T |
48615542 |
cccgtgagcataactcagttggtagggatattgcatattatatgcagaagccgggg |
48615487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 55238573 - 55238522
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
55238573 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
55238522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 637096 - 637154
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| ||||| || ||| |||||||||||||||||||||||| |||| |
|
|
| T |
637096 |
atccccgtgagcttagctcagctggtaggaatattgcatattatatgcaggagccgggg |
637154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 4105727 - 4105773
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
4105727 |
cccgtgagcttagctcagttgatagggatattgcattttatatgcag |
4105773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 8282343 - 8282389
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
8282343 |
ccgtgagcttaactcaattgataaggatattgcatattatatgcagg |
8282389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 152
Target Start/End: Original strand, 21116776 - 21116826
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
21116776 |
ttatccccgtgagcttaactcagttgttaagaatattgcatattatatgca |
21116826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 30217600 - 30217646
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30217600 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30217646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 35219574 - 35219510
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||| ||||||||| | |||||||||| |
|
|
| T |
35219574 |
tatccccgtgagcttagctcagttggtagggatattgcatatta-atgcaggag-tcggggttcgaa |
35219510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 40051619 - 40051665
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
40051665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 43271786 - 43271740
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
43271786 |
ccgtgagcttagttcagttgatagggatattgcatattatatgcagg |
43271740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 43481112 - 43481062
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
43481112 |
atccccgtgagcttaactcagttggtagggatattgcactttatatgcagg |
43481062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 44602482 - 44602532
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
44602532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 99 - 157
Target Start/End: Original strand, 45741467 - 45741525
Alignment:
| Q |
99 |
ttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||| ||||||||| |||||||||||||| |
|
|
| T |
45741467 |
ttgttatccccgtgagtttaactcaattggtaggaatattgcatgttatatgcaggagc |
45741525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 103 - 157
Target Start/End: Original strand, 46582630 - 46582684
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||| ||||| ||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
46582630 |
tatccctgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
46582684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 47934145 - 47934095
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggatatggcatattatatgcagg |
47934095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 49757357 - 49757299
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
49757357 |
atccccgtgagcatagctcagttggtaggaatattgcatattatatgcaggagccgggg |
49757299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 4590241 - 4590298
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||||||| ||| |||||||| ||| ||||||||||||||||| |||| |||| |
|
|
| T |
4590241 |
ttatccccgtgagtttagctcagttggtagggatattgcatattatatacaggggctg |
4590298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 119 - 160
Target Start/End: Original strand, 12678519 - 12678560
Alignment:
| Q |
119 |
actcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
12678519 |
actcagttggtagagatattgcatattatatgcaggggctgg |
12678560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 149
Target Start/End: Original strand, 15208519 - 15208564
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
15208519 |
atccccgtgagcttaactcagtgggtagggatattgcatattatat |
15208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 166
Target Start/End: Original strand, 22055280 - 22055337
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttc |
166 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| |||||||| || | |||||||| |
|
|
| T |
22055280 |
cgtgagcttaactcagttgataaagatcttgcatactatatgcaagatccgggggttc |
22055337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 152
Target Start/End: Original strand, 32339320 - 32339369
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||| || |||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32339320 |
tatcctcgcgagcttaactcagttgttagggatattgcatattatatgca |
32339369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 34019520 - 34019471
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| || |||||||||| |
|
|
| T |
34019520 |
atcctcgtgagtttaactcagttgatagagatattgtattttatatgcag |
34019471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 153
Target Start/End: Original strand, 34353780 - 34353825
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
34353780 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcag |
34353825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 46657507 - 46657548
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
46657507 |
cgtgagcttaactcagttgacagagacattgcatattatatg |
46657548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 52483252 - 52483192
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||| |||||||||||||| |||||| |||| |
|
|
| T |
52483252 |
gttatccccgtgagcttagctcagttggtag-gatgttgcatattatatgtaggagcagggg |
52483192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 56479294 - 56479249
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
56479294 |
cgtgaacttaactcagttggtagggatattgcatattatatgcagg |
56479249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 627049 - 626997
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
627049 |
gtgagtttagctcagttggtagggatattgcatattatatgcaagagctgggg |
626997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 10417294 - 10417242
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||| |||||||| |||||||| ||| |||||| ||||||||||||||||| |
|
|
| T |
10417294 |
atccccatgagcttagctcagttggtagggatattacatattatatgcaggag |
10417242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 26347139 - 26347091
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||||||||| ||||||||| |
|
|
| T |
26347139 |
atccccgtgagtttaactcagttaatagggatattgcatgttatatgca |
26347091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 42218745 - 42218805
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||| |||||||| ||| |||||||||||||||| | ||| ||||||| |
|
|
| T |
42218745 |
ttatccccgtgaacttagctcagttggtagggatattgcatattatacgtaggggctgggg |
42218805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 50457789 - 50457737
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
50457789 |
ttattcccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
50457737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 103 - 151
Target Start/End: Complemental strand, 51512083 - 51512035
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
|||||||||||||| | |||||||| ||| ||||||||||||||||||| |
|
|
| T |
51512083 |
tatccccgtgagctgagctcagttggtagggatattgcatattatatgc |
51512035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 3157291 - 3157240
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
3157291 |
tatccccgtgaacttagctcagttggtaggaatattgcatattatatgcagg |
3157240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 12582098 - 12582043
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| | || ||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12582098 |
cccgtgagctaatcttagttggtagggatattgcatattatatgcaggagccgggg |
12582043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 18424967 - 18424924
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||| ||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18424967 |
cccgtgaacttaactcagttggtagggatattgcatattatatg |
18424924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 27743778 - 27743731
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| || |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
27743778 |
cccgtgagcgtagctcagttggtagggatattgcatattatatgcagg |
27743731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 150
Target Start/End: Complemental strand, 31852687 - 31852640
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||| |||||||| ||| | |||||||||||||||| |
|
|
| T |
31852687 |
tatccccgtgagcttatctcagttggtagggttattgcatattatatg |
31852640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 37719000 - 37719047
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
37719000 |
cccgtgagcttaactcagttgttagggatatcgcattttatatgcagg |
37719047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 109 - 156
Target Start/End: Complemental strand, 39696405 - 39696358
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
39696405 |
cgtgagcttagctcagttggtagggatattgcatattatatgtaggag |
39696358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 157
Target Start/End: Original strand, 49056774 - 49056825
Alignment:
| Q |
107 |
cccgtgagcttaa-ctcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||| |||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
49056774 |
cccgtgagcttaagctcagttggtagggacattgcatattatatgcaggagc |
49056825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 52757352 - 52757301
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
52757352 |
tatccccgtgagcttagctcagttggcaggaatattgcatattatatgcagg |
52757301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 2771037 - 2771083
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
2771037 |
ccgtgagcttagctcagctgatatggatattgcatattatatgcagg |
2771083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 4357879 - 4357925
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||| |||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
4357879 |
atccccgtgaacttagctcagttggtagagatattgtatattatatg |
4357925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 13264349 - 13264299
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||| ||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
13264349 |
ttatccccatgagcttcgctcagttggtagggatattgcatattatatgca |
13264299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 21935474 - 21935524
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
21935474 |
atccccgcaagcttagctcagttggtagggatattgcatattatatgcagg |
21935524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 115 - 153
Target Start/End: Original strand, 23241522 - 23241560
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
23241522 |
cttaattcagttgacagagatattgcatattatatgcag |
23241560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 34040425 - 34040471
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| |||||||||| ||||||||||||| ||||||||| ||||||| |
|
|
| T |
34040425 |
atccacgtgagcttagctcagttgatagaaatattgcattttatatg |
34040471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 35465432 - 35465482
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| |||||| |||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggatattgcattttatatacagg |
35465482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 160
Target Start/End: Complemental strand, 37868634 - 37868584
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
|||||||||||| |||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
37868634 |
gtgagcttaacttagttagtagtgatattgcatattatatgcaggggctgg |
37868584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 152
Target Start/End: Complemental strand, 42134532 - 42134482
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| ||| |||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
42134532 |
ttattcccatgagcttaactcagttagtagggatattgcatattatatgca |
42134482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 48798276 - 48798333
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| ||||| ||||| ||||||| |
|
|
| T |
48798276 |
atccccgtgagcttagctcagttggtagggatattgcattttata-gcaggggctgggg |
48798333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 48825891 - 48825833
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||| ||| ||| ||||| | || |||||||||||||| |||| |
|
|
| T |
48825891 |
atccccgtgagcttaactcaattggtagggatatcgaattttatatgcaggagccgggg |
48825833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 49315991 - 49316037
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
49315991 |
cccgtgagcttaactcagttgataaggatattgtatattatacgcag |
49316037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 49447118 - 49447176
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| |||||||| |||||||| || |||||||||||||||||| |||||| |||| |
|
|
| T |
49447118 |
atccccatgagcttagctcagttggtaaggatattgcatattatatgtaggagccgggg |
49447176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 50512357 - 50512407
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| |||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
50512357 |
atccccatgagcttagctcagttggtaggaatattgcatattatatgcagg |
50512407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 10407101 - 10407053
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||| |||||||| |
|
|
| T |
10407101 |
gtgagcttagctcagttggtag-gatattgcatattatatgtaggagctg |
10407053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 21380256 - 21380203
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||| ||| |||| ||| ||| |||||||||||||||| ||||||| |
|
|
| T |
21380256 |
tatccccgtgagtttagctcaattgctagggatattgcatattataagcaggag |
21380203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 133 - 162
Target Start/End: Original strand, 22819434 - 22819463
Alignment:
| Q |
133 |
gatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22819434 |
gatattgcatattatatgcaggagctgggg |
22819463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 29771367 - 29771322
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| |||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
29771367 |
cgtgagcttagctcaattggtagggatattgcatattatatgcagg |
29771322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 33933811 - 33933762
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| |||||||| ||| || |||||||| |||||||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
33933762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 36132226 - 36132290
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||| ||| |||| ||| ||| ||||||||||||||||||||||| | |||||||||| |
|
|
| T |
36132226 |
atccccgtgagtttagctcaattggtaggaatattgcatattatatgcaggag-tcggggttcgaa |
36132290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 50376717 - 50376672
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||| |||||||||| |
|
|
| T |
50376717 |
cgtgagtttaactcagttggtagagacattgcataatatatgcagg |
50376672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 52699191 - 52699236
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
52699191 |
cgtgagtttaactcagttgataggaatattgcatattatatacagg |
52699236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 161
Target Start/End: Complemental strand, 53634324 - 53634267
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||| |||||||| |||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
53634324 |
atccccatgagcttagttcagttcgtagggatattgcatattatatacaggagctggg |
53634267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 55238789 - 55238748
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
55238789 |
ccgtgagtttaactcagttaatagagatattgcataatatat |
55238748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 101 - 149
Target Start/End: Complemental strand, 6460148 - 6460100
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| | |||||| ||||| |
|
|
| T |
6460148 |
gttatccccgtgagtttaactcagttaatagagacaatgcataatatat |
6460100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 7657058 - 7657110
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| || ||| ||| |||||||||||||| |
|
|
| T |
7657058 |
ttatccccgtgagcttatctcagttggtaaggatgttgtatattatatgcagg |
7657110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 11826454 - 11826502
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgat-agagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||| | | |||||||| |||||||||||||| |
|
|
| T |
11826454 |
cccgtgagcttaactcagttggtaaaagatattgtatattatatgcagg |
11826502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 149
Target Start/End: Original strand, 21432616 - 21432656
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
21432616 |
cgtgagcttagttcagttggtagagatattgcatattatat |
21432656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 149
Target Start/End: Original strand, 27627189 - 27627225
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||| |
|
|
| T |
27627189 |
agcttaactcagttggtatagatattgcatattatat |
27627225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 42073154 - 42073202
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||| |||| |||| ||| |||||||||||||| ||||||| |
|
|
| T |
42073154 |
ttatccccgtgaacttagctcacttggtagagatattgcattttatatg |
42073202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 9477510 - 9477459
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||| |||||||| ||| | ||||||||||||||||||||||| |
|
|
| T |
9477510 |
tatccacgtgagtttaactcaattggttaagatattgcatattatatgcagg |
9477459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 9972124 - 9972171
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||| || |||||||||||||||||||||| || ||| |||||||| |
|
|
| T |
9972124 |
tccccgcgaacttaactcagttgatagagataatgtataatatatgca |
9972171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 113 - 152
Target Start/End: Original strand, 12499460 - 12499499
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
12499460 |
agcttaactcaattgatagagatactgcataatatatgca |
12499499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 156
Target Start/End: Complemental strand, 15064270 - 15064223
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||| ||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15064270 |
cgtgagtttagctcagttggtaggaatattgcatattatatgcaggag |
15064223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 15604110 - 15604063
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| ||| |||||| ||||||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggatgttgcattttatatgcagg |
15604063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 16733581 - 16733538
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||| ||||| || ||| |||||||| |
|
|
| T |
16733581 |
cgtgagcttaactcagttgataaagataatgtataatatatgca |
16733538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 18360489 - 18360540
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
18360489 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
18360540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 150
Target Start/End: Original strand, 25526447 - 25526486
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||| ||| ||||||| |||||||||| |
|
|
| T |
25526447 |
tgagcttaactcagttggtagggatattgtatattatatg |
25526486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 27550796 - 27550753
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||||| |||||||| |
|
|
| T |
27550796 |
cgtgagcttaactcagttgaaagaaataatgcataatatatgca |
27550753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 36602440 - 36602389
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
36602440 |
tatccccgtgagcttagctcagttggtagggatatcacattttatatgcagg |
36602389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 121 - 148
Target Start/End: Original strand, 38413548 - 38413575
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattata |
148 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
38413548 |
tcagttgatagagatattgcatattata |
38413575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 100 - 154
Target Start/End: Complemental strand, 40666924 - 40666869
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagaga-tattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||||||||||||||| | ||| | ||||||||||||||||| |
|
|
| T |
40666924 |
tgttgtccccgtgagcttaactcagttgacaaagacaaatgcatattatatgcagg |
40666869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 174
Target Start/End: Original strand, 42425888 - 42425950
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcg |
174 |
Q |
| |
|
|||| |||||||||||| || |||||||||||||||||||| ||| | |||||||||| |||| |
|
|
| T |
42425888 |
tgagattaactcagttgctatggatattgcatattatatgca-gaggttggggttcgaacctcg |
42425950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 43905718 - 43905757
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
43905718 |
cttaactcagttggtagggatattgcatgttatatgcagg |
43905757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 44312854 - 44312807
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
44312854 |
cccgcgagcttagctcagttggtagggatattgcattttatatgcagg |
44312807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 144
Target Start/End: Complemental strand, 47230973 - 47230938
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatat |
144 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||| |
|
|
| T |
47230973 |
cgtgagcttagctcagttggtagagatattgcatat |
47230938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 150
Target Start/End: Original strand, 54029553 - 54029596
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
54029553 |
cccgtgagcttaattcagttggcagagatattacatattatatg |
54029596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 101 - 157
Target Start/End: Original strand, 112102 - 112158
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
112102 |
gttatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
112158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 48; Significance: 8e-19; HSPs: 154)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 882385 - 882444
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
882385 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
882444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 7269952 - 7270010
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
7269952 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
7270010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 22472387 - 22472329
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||| |||| |
|
|
| T |
22472387 |
atccccgtgagcttaactcagttggtagagatattgcatattatatgcaagagccgggg |
22472329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 52974126 - 52974068
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
52974126 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
52974068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 10482929 - 10482868
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| |||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
10482929 |
gttatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggagctgggg |
10482868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 101 - 162
Target Start/End: Complemental strand, 50496890 - 50496829
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
50496890 |
gttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
50496829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 2522921 - 2522981
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
2522921 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagctgggg |
2522981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 37800686 - 37800626
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
37800686 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
37800626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 40933906 - 40933846
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
40933906 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
40933846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 45701339 - 45701399
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
45701339 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
45701399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 48251567 - 48251627
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| ||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
48251567 |
ttatccctgtgagcttagctcagttgatagggatattgcatattatatgcaggagccgggg |
48251627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 158
Target Start/End: Original strand, 19550502 - 19550557
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagct |
158 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
19550502 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagct |
19550557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 19999864 - 19999922
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
19999922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 22502004 - 22501946
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
22502004 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
22501946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 31327574 - 31327516
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
31327516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 31327791 - 31327733
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
31327733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 40548300 - 40548358
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
40548358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 103 - 157
Target Start/End: Complemental strand, 44652056 - 44652002
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
44652056 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
44652002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 50536905 - 50536855
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
50536905 |
atccccgtgagcttagctcagttggtagagatattgcatattatatgcagg |
50536855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 103 - 156
Target Start/End: Complemental strand, 2007157 - 2007104
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||| ||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
2007157 |
tatccccgtgaacttaactcagttggtagaaatattgcatattatatgcaggag |
2007104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 102 - 179
Target Start/End: Original strand, 15975147 - 15975223
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||| ||||||||| |||||||| ||| ||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
15975147 |
ttatccctgtgagcttagctcagttggtagggatattgcatattatatgcaggagc-cggggttcgaacctcggacac |
15975223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 109 - 162
Target Start/End: Complemental strand, 49750474 - 49750421
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
49750474 |
cgtgagcttagctcagttgatagggatattgcatattatatgcaggggctgggg |
49750421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 52410314 - 52410261
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
52410261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 106 - 162
Target Start/End: Complemental strand, 6920034 - 6919978
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
6919978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 40963786 - 40963734
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
40963786 |
ttatccccgtgagcttaactcagttgataaggatattgcattttatatgcagg |
40963734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 106 - 162
Target Start/End: Original strand, 50234123 - 50234179
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
50234123 |
ccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagccgggg |
50234179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 53347365 - 53347313
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
53347365 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
53347313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 4139000 - 4139055
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
4139055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 18194334 - 18194393
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
18194334 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
18194393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 25939004 - 25938945
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
25939004 |
tatccccgtgagtttagctcagttggtagggatattgcatattatatgcaggggctgggg |
25938945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 29098688 - 29098739
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
29098688 |
tatccccgtgaacttaactcagttggtagagatattgtatattatatgcagg |
29098739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 34847539 - 34847590
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34847539 |
tatccccgtgagcttaattcagttggtagggatattgcatattatatgcagg |
34847590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 153
Target Start/End: Original strand, 44364016 - 44364067
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||| |||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
44364016 |
ttatccccgtgagtttaactcagttggtagggatattgcatattatatgcag |
44364067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 48739818 - 48739759
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
48739818 |
tatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggctgggg |
48739759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 52309181 - 52309119
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||| |||||||||||| | |||||||||| |
|
|
| T |
52309181 |
ccccgtgagcttaactcagttggtagggatattgcatactatatgcaggag-tcggggttcgaa |
52309119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 87 - 154
Target Start/End: Complemental strand, 53432826 - 53432760
Alignment:
| Q |
87 |
taaaacttggttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||| ||||||| ||||| |||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
53432826 |
taaaacttg-ttttcttatccctgtgagtttaactcagttggtagggatattgcatattatatgcagg |
53432760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 2368933 - 2368991
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
2368933 |
atcctcgtgagcttagctcagttgttagggatattgcatattatatgcaggggctgggg |
2368991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 158
Target Start/End: Complemental strand, 2390427 - 2390373
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagct |
158 |
Q |
| |
|
|||||||| ||| || |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
2390427 |
atccccgtaagcgtagctcagttgatagggatattgcatattatatgcaggagct |
2390373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 113 - 179
Target Start/End: Complemental strand, 4640544 - 4640479
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||| |||||||| ||| |||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
4640544 |
agcttagctcagttggtagggatattgcatattatatgcaggagct-ggggttcgaacctcgaacac |
4640479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 7920317 - 7920375
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||| |||| |||| |
|
|
| T |
7920317 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagccgggg |
7920375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 10176976 - 10176918
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10176976 |
atccccgtgaggttagctcagttggtagggatattgcatattatatgcaggagccgggg |
10176918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 11234439 - 11234497
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
11234439 |
atccccgtgagcttagctcagttagtagagatattgtattttatatgcaggagctgggg |
11234497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 17608392 - 17608342
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
17608392 |
atccccgtgagcttaacttagttggtagggatattgcatattatatgcagg |
17608342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 19996525 - 19996467
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
19996525 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagttgggg |
19996467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 28550392 - 28550342
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
28550342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 28689746 - 28689681
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||| |||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
28689746 |
tatccccgtgaacttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
28689681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 39966147 - 39966097
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
39966097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 153
Target Start/End: Original strand, 40192152 - 40192202
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
40192152 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
40192202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 52945892 - 52945942
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
52945942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 53752773 - 53752723
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
53752773 |
atccccgtgagcttaactcagttggtagggatatggcatattatatgcagg |
53752723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 97 - 162
Target Start/End: Complemental strand, 8964856 - 8964791
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||| ||| |||||||||||| |||||||||||| |||| |
|
|
| T |
8964856 |
tttttttatccccgtgagtttagctcagttggtagggatattgcatatcatatgcaggagccgggg |
8964791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 31529031 - 31528967
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
31529031 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggag-tcggggttcgaa |
31528967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 5636866 - 5636814
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
5636866 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
5636814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 108 - 179
Target Start/End: Original strand, 25833824 - 25833893
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||| |||||| |||||||| || |||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
25833824 |
ccgttagcttagctcagttggtaaagatattgcatattatatgcaggagc--ggggttcgaacctcgaacac |
25833893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 28193793 - 28193845
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| ||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
28193793 |
ttatccccttgagcttaactcagttggtagggatattgcattttatatgcagg |
28193845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 30555302 - 30555242
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||| ||||| |||| |||| |
|
|
| T |
30555302 |
ttatccccgtgagcttagctcagttggtagggatattgcatattaaatgcaagagcagggg |
30555242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 32828441 - 32828493
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||| ||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
32828441 |
cccgtgagcttagctcggttggtagggatattgcatattatatgcaggagctg |
32828493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 34898841 - 34898785
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||| ||||||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
34898841 |
tatccccgtgagcttagttcagttggtagggatattgcatattatatgcaggggctg |
34898785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 9176656 - 9176601
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||| |||| |||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaagagccgggg |
9176601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 159
Target Start/End: Original strand, 13018786 - 13018841
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||| ||| |||| |||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
13018786 |
atccccttgaacttagttcagttgatagagatattgcatattatatgcaggggctg |
13018841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 109 - 156
Target Start/End: Original strand, 25934048 - 25934095
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
25934048 |
cgtgagcttaacttacttggtagagatattgcatattatatgcaggag |
25934095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 29373519 - 29373472
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
29373519 |
cccgtgagcttaactcagttggtaaggatattgcatattatatgcagg |
29373472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 30779641 - 30779590
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30779641 |
tatcctcgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30779590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 149
Target Start/End: Original strand, 31316629 - 31316676
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
31316629 |
ttatccccgtgagcttagctcagttgatagggatattgtatattatat |
31316676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 32256628 - 32256577
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
32256628 |
tatccccgtgagcttagctcagttggtagggatattgcatgttatatgcagg |
32256577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 36625237 - 36625186
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
36625237 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagttgggg |
36625186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 47098732 - 47098779
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
47098779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 174
Target Start/End: Original strand, 49408771 - 49408841
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcg |
174 |
Q |
| |
|
|||||||||||||||| ||||| || ||| ||||| |||||||||||||||||| | |||||||||| |||| |
|
|
| T |
49408771 |
tatccccgtgagcttagctcagctggtagggatatcgcatattatatgcaggag-tcggggttcgaacctcg |
49408841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 3748675 - 3748625
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
3748675 |
atccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
3748625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 8762153 - 8762103
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||| ||||||||||||||| |
|
|
| T |
8762153 |
atccccgtgagcttaacttagttggtagggatattacatattatatgcagg |
8762103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 11436501 - 11436551
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
11436501 |
atcctcgtgaacttaactcagttggtagggatattgcatattatatgcagg |
11436551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 100 - 162
Target Start/End: Complemental strand, 19591656 - 19591594
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
19591656 |
tgttatccccttgagcttagctcagttgataagtatattgcatattatatgtaggagccgggg |
19591594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 24430146 - 24430192
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24430146 |
cccgtgagcttagctcagttggtagagatattgtatattatatgcag |
24430192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 31586944 - 31586994
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| |||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
31586944 |
atccccatgagcttagctcagttggtagggatattgcatattatatgcagg |
31586994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 32144581 - 32144639
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| || ||||| ||| | ||||||||||||||||||||||| |||| |
|
|
| T |
32144581 |
atccccgtgagcttagcttagttggtaggggtattgcatattatatgcaggagccgggg |
32144639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 33225421 - 33225363
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| |||| |||||||||||||| |||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggagccgggg |
33225363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 34102684 - 34102634
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34102684 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcagg |
34102634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 41936480 - 41936430
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
41936480 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
41936430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 46796002 - 46795952
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
46796002 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
46795952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 49447135 - 49447193
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
49447135 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggagccgggg |
49447193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 53163591 - 53163637
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
53163637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 8125641 - 8125686
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8125641 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8125686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 11820001 - 11820065
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| ||||||| ||||| | |||||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggatattgcatgttatatgtaggag-tcggggttcgaa |
11820065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 152
Target Start/End: Original strand, 17218484 - 17218533
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||| |||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
17218484 |
tatccccatgagcttagctcagttggtagggatattgcatattatatgca |
17218533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 149
Target Start/End: Complemental strand, 44685241 - 44685196
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||||||||||||||| |
|
|
| T |
44685241 |
atccccgtgagcttagcttagttggtagagatattgcatattatat |
44685196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 4200652 - 4200608
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4200652 |
gtgaacttaactcagttggtagggatattgcatattatatgcagg |
4200608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 144
Target Start/End: Original strand, 10349402 - 10349442
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatat |
144 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
10349402 |
atccccgtgagcttagctcagttgatagggatattgcatat |
10349442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 39719930 - 39719982
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||| ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
39719930 |
ttattcccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
39719982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 114 - 154
Target Start/End: Original strand, 44106609 - 44106649
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
44106609 |
gcttaactcagttgctagggatattgcatattatatgcagg |
44106649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 109 - 153
Target Start/End: Original strand, 46879999 - 46880043
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| |||||||||| |
|
|
| T |
46879999 |
cgtgagcttagctcagttgatagggatattgcattttatatgcag |
46880043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 51425835 - 51425887
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
51425835 |
ttatccccgtgagcttaactcagttggtagggatatcacattttatatgcagg |
51425887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 51772892 - 51772936
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||||||||||||||| |
|
|
| T |
51772892 |
gtgagcttaacttagttggtagggatattgcatattatatgcagg |
51772936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 3894544 - 3894599
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
3894544 |
cccgtgagcttagttcagttggtatggatattgcatattatatgcaggagccgggg |
3894599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 4541898 - 4541953
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
4541898 |
cccgtgagcttagttcagttggtagggatattgtatattatatgcaggggctgggg |
4541953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 6488120 - 6488171
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| |||||||| |||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
6488120 |
tatccccatgagcttagctcaattggtagggatattgcatattatatgcagg |
6488171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 12894600 - 12894557
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
12894600 |
cccgtgagcttaactcagttggtagggatattgcattttatatg |
12894557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 21405159 - 21405218
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| || |||||||||| | ||||| ||||||||||| |
|
|
| T |
21405159 |
tatccccgtgagcttacctcagttggaagggatattgcatttaatatgtaggagctgggg |
21405218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Original strand, 25488885 - 25488928
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||| ||| |||||| ||||||||||| |
|
|
| T |
25488885 |
cccgtgagcttaactcagttgttagggatattacatattatatg |
25488928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 25638459 - 25638416
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||| ||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
25638459 |
cccgtgaacttaactcaattggtagagatattgcatattatatg |
25638416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 26942753 - 26942800
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
26942753 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
26942800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 154
Target Start/End: Complemental strand, 28396848 - 28396805
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
28396848 |
tgagcttaactcagttggtagggatattgcatgttatatgcagg |
28396805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 150
Target Start/End: Complemental strand, 29559740 - 29559701
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
29559740 |
tgagcttaactcagttggtagggatattgcatattatatg |
29559701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 34579520 - 34579477
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| || ||||||| |
|
|
| T |
34579520 |
cccgtgagcttaactcagttgatagggatattgaattttatatg |
34579477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 39169758 - 39169808
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
39169758 |
tatccctgtgagcttaactcagttagtagagatattgcata-tatatgcagg |
39169808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 40723733 - 40723686
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
||||||| |||||||||||||||| ||| |||||||||| |||||||| |
|
|
| T |
40723733 |
atccccgagagcttaactcagttggtagggatattgcatgttatatgc |
40723686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 109 - 148
Target Start/End: Complemental strand, 46045488 - 46045449
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattata |
148 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
46045488 |
cgtgagcttaactcagttgataaggatattgcatattata |
46045449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Original strand, 48546173 - 48546216
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
48546173 |
cccgtgagcttagctcagttggtagtgatattgcatattatatg |
48546216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 152
Target Start/End: Original strand, 552174 - 552216
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||| |||||||| |
|
|
| T |
552174 |
gtgagcttaactcagttggtagggatattgcataatatatgca |
552216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 1743870 - 1743824
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||||||||| ||||||| |
|
|
| T |
1743870 |
atccccgtgagcttaactcaattggtagggatattgcattttatatg |
1743824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 2106037 - 2106071
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2106037 |
ctcagttgatagagacattgcatattatatgcagg |
2106071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 5326106 - 5326056
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||| ||||| |||| |
|
|
| T |
5326106 |
cccgtgagcttagctcagttggtagcgatattgcatattacatgcatgagc |
5326056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 13638318 - 13638260
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||| ||||||||||| ||| ||||||| |
|
|
| T |
13638318 |
atccccgtgagcttagttcagttggtagggatattacatattatatgtaggggctgggg |
13638260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 16895304 - 16895258
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
16895304 |
tatccccgagagcttaactcagttggtaggaatattgcatattatat |
16895258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 31922353 - 31922411
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||| |||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
31922353 |
atccccgtgagcttgtctcagttggtaagaatattgcatattatatgcaggagccgggg |
31922411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 33706800 - 33706742
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||| ||| ||| |||||| ||||||||||||| |||| |||| |
|
|
| T |
33706800 |
atccccgtgagcttagctcaattggtagggatattacatattatatgcaagagccgggg |
33706742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 121 - 159
Target Start/End: Original strand, 36741185 - 36741223
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
36741185 |
tcagttgatagagatattacataatatatgcaggagctg |
36741223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 37488533 - 37488483
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
37488483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 156
Target Start/End: Complemental strand, 38562236 - 38562190
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
38562236 |
gtgagcttacctcaattgataaggatattgcatattatatgcaggag |
38562190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 39300381 - 39300438
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||| ||||| ||||||||||||| |
|
|
| T |
39300381 |
atccccgtgagcttagctcagttggtagggatattacattttata-gcaggagctgggg |
39300438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 45871014 - 45871064
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
45871014 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgcagg |
45871064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 51467173 - 51467223
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| |||| |||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
51467173 |
atccccgtgaacttagctcagttgatagggatatcgcattttatatgcagg |
51467223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 54769899 - 54769853
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
54769899 |
ccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
54769853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 8756526 - 8756571
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||| ||||||||||| |
|
|
| T |
8756526 |
cgtgagcttaactcagttggtaggaatattgcattttatatgcagg |
8756571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 11250659 - 11250614
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
11250659 |
cgtgaacttagctcagttggtagggatattgcatattatatgcagg |
11250614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 161
Target Start/End: Original strand, 15492088 - 15492145
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||| ||||||||||| ||||| ||| |||||||||| ||||||| ||| |||||| |
|
|
| T |
15492088 |
atccccatgagcttaactgagttggtagggatattgcattttatatgaaggggctggg |
15492145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 17561087 - 17561128
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
17561087 |
cgtgagcttaactaagttgatagagatattgcgcattatatg |
17561128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Complemental strand, 17602744 - 17602703
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
17602703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 42268790 - 42268831
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
42268790 |
agcttaattcagttggtagggatattgcatattatatgcagg |
42268831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 157
Target Start/End: Original strand, 43645076 - 43645125
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||| ||||||||| || |||||| ||||||||| |||||||| |
|
|
| T |
43645076 |
ccgtgagcttagctcagttgacagggatatttcatattatacgcaggagc |
43645125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 46730842 - 46730797
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||| |||||||||||| |||| ||||||||||||||| |
|
|
| T |
46730842 |
ccgtgagcttagctcagttgataggcatatagcatattatatgcag |
46730797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 159
Target Start/End: Original strand, 4860161 - 4860213
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||| |||||||| || |||||||||| ||||||||||| |||| |
|
|
| T |
4860161 |
cccgtgagcttagctcagttggtacggatattgcattttatatgcaggggctg |
4860213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 150
Target Start/End: Original strand, 21356867 - 21356907
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| |||||| |
|
|
| T |
21356867 |
gtgagcttaactcagttgatagatatattgtataatatatg |
21356907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Original strand, 27983858 - 27983902
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||| ||||||||||| |
|
|
| T |
27983858 |
gtgagcttagctcagttggtagaaatattgcattttatatgcagg |
27983902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 31673316 - 31673264
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
31673316 |
gtgagcttgtctcagttggtaaggatattgcatattatatgcaggagccgggg |
31673264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 36834772 - 36834728
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| ||||| |||||| ||||||| |||||||||||||| |
|
|
| T |
36834772 |
gtgagcttagctcagctgatagggatattgtatattatatgcagg |
36834728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 103 - 155
Target Start/End: Complemental strand, 37097129 - 37097078
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
|||||| || ||||||||||||||||||| |||||||||| ||| |||||||| |
|
|
| T |
37097129 |
tatccctgtaagcttaactcagttgatag-gatattgcattttacatgcagga |
37097078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 41215159 - 41215119
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
41215159 |
gtgagtttaactcaattaatagagatattgcatattatatg |
41215119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 157
Target Start/End: Original strand, 49728689 - 49728748
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||| |||||||| ||||||||||||| ||| ||| |||||||||| ||||||||| |||| |
|
|
| T |
49728689 |
tttttttatcccc-tgagcttaactcaattggtagggatattgcattttatatgcaagagc |
49728748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 50659585 - 50659637
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||| ||| ||||||||||| |
|
|
| T |
50659585 |
ttatcctcgtgagcttaactcagttggtagggatatcacattttatatgcagg |
50659637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 50727319 - 50727271
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
50727319 |
ttatccccgtgagcctaactcagttggtagggatatcgcattttatatg |
50727271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 50785529 - 50785577
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||| ||||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
50785529 |
ttatccccgtgagcctaactcagttggtagggatatcgcattttatatg |
50785577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 162
Target Start/End: Original strand, 53577958 - 53578010
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| |||||||| ||| ||| |||||||||||||||| |||| |||| |
|
|
| T |
53577958 |
gtgagcttagctcagttggtagggatgttgcatattatatgcaagagccgggg |
53578010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 54021401 - 54021357
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
54021401 |
gtgagcttagctcagttggtatggatattgcatattatatgcagg |
54021357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 1697917 - 1697870
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcata-ttatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
1697917 |
ccgtgagcttaactcagttagtagggatattgcatatttatatgcagg |
1697870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 102 - 153
Target Start/End: Original strand, 14005014 - 14005065
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||| ||| |||||||| |||||||||| || |||||||||| |
|
|
| T |
14005014 |
ttatccccgtgagtttagctcagttggtagagatattatattttatatgcag |
14005065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 134 - 161
Target Start/End: Complemental strand, 17472373 - 17472346
Alignment:
| Q |
134 |
atattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
17472373 |
atattgcatattatatgcaggagctggg |
17472346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 17728992 - 17729038
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||| ||||| | |||||||||||||||||||||| |
|
|
| T |
17728992 |
cccgtgagcttagctcaattgattg-gatattgcatattatatgcagg |
17729038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 19030221 - 19030267
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||| ||||| | |||||||||||||||||||||| |
|
|
| T |
19030221 |
cccgtgagcttagctcaattgattg-gatattgcatattatatgcagg |
19030267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 20489819 - 20489862
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||||| ||| | |||||||||||||||||||| |
|
|
| T |
20489819 |
tgagcttagctcagttggtagggttattgcatattatatgcagg |
20489862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 114 - 153
Target Start/End: Original strand, 22857401 - 22857440
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
22857401 |
gcttaactcagttggtaggaatattgcatattatatgcag |
22857440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 35126337 - 35126278
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||| |||||||||||| ||| |||| |||||| |||||||| || |||||| |
|
|
| T |
35126337 |
tatctccgtgagtttaactcagttggtagggataatgcataatatatgcaagatctgggg |
35126278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 45513069 - 45513010
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| |||||| ||||||| || ||||||||||||||||| |||||| ||||| |
|
|
| T |
45513069 |
tatccccgtaagcttagctcagttagtatggatattgcatattatatacaggagttgggg |
45513010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 52670223 - 52670180
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
52670223 |
cccgtgagcttagttcagttggtagggatattgcatattatatg |
52670180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 97 - 152
Target Start/End: Original strand, 52984000 - 52984055
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||| ||| || ||||||||| |||||||| ||| ||||||||||||| |||||| |
|
|
| T |
52984000 |
ttttgatattcctgtgagcttagctcagttggtagggatattgcatattgtatgca |
52984055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 47; Significance: 3e-18; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 17617 - 17675
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
17675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 47; Significance: 3e-18; HSPs: 157)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 11875883 - 11875941
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
11875883 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
11875941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 11890890 - 11890948
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
11890890 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
11890948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 26567323 - 26567269
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
26567323 |
ttatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggag |
26567269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 37717360 - 37717418
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
37717360 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
37717418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 133412 - 133476
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
133412 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcaggag-tcggggttcgaa |
133476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 8034488 - 8034435
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8034488 |
gttatccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
8034435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 38344051 - 38344104
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
38344051 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggagctgggg |
38344104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 29514621 - 29514681
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
29514621 |
ttatccccgtgagcttagctcagttggtagggatattgtatattatatgcaggagctgggg |
29514681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 10200755 - 10200696
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||| |||||||||| |||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
10200755 |
tatcctcgtgagcttagctcagttggtagagatattgcatattatatgcaggagccgggg |
10200696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 102 - 157
Target Start/End: Original strand, 13406595 - 13406650
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||| |||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
13406595 |
ttatctccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
13406650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 17698518 - 17698577
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
17698518 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
17698577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 34472297 - 34472352
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
34472297 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcaggagttgggg |
34472352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 103 - 157
Target Start/End: Complemental strand, 94585 - 94531
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
94585 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
94531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 2792776 - 2792826
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
2792776 |
atccccgtgagcttagctcagttgatagggatattgcatattatatgcagg |
2792826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 10736947 - 10736889
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
10736947 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
10736889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 20540179 - 20540121
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
20540179 |
atccccgtgagcttagctcagttgttagggatattgcatattatatgcaggggctgggg |
20540121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 23435306 - 23435248
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
23435306 |
atccctgtgagcttagctcagttgatagggatattgcatattatatgcaggagccgggg |
23435248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 29716857 - 29716915
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
29716915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 108 - 162
Target Start/End: Complemental strand, 31451026 - 31450972
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31451026 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
31450972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 33617969 - 33618019
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33617969 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
33618019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 34413059 - 34413117
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
34413059 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
34413117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 42880945 - 42881003
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||| |||||| |||| |
|
|
| T |
42880945 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgtaggagccgggg |
42881003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 109 - 159
Target Start/End: Complemental strand, 45190627 - 45190577
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45190627 |
cgtgagcttaactcggttgatagagatattgcatattatatgcaggggctg |
45190577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 1937306 - 1937359
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
1937306 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
1937359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 12300 - 12248
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
12300 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
12248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 103 - 179
Target Start/End: Original strand, 34266008 - 34266083
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||| ||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |||| |||| |
|
|
| T |
34266008 |
tatccccgcgagcttagctcagttggtagggatattgcatattatatgcaggag-ttggggttcgaacctcggacac |
34266083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 109 - 161
Target Start/End: Original strand, 41458297 - 41458349
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
41458297 |
cgtgagcttaactcagttggtagggatattgcatattatatgcaggggctggg |
41458349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 41689877 - 41689929
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
41689877 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41689929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 6659285 - 6659344
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6659285 |
tatccccgtgagattagctcagttggtagggatattgcatattatatgcaggagccgggg |
6659344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 6739687 - 6739746
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
6739687 |
tatccccgtgagattagctcagttggtagggatattgcatattatatgcaggagccgggg |
6739746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 7388451 - 7388502
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
7388451 |
tatccccgtgaacttaactcagttggtagggatattgcatattatatgcagg |
7388502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 8265264 - 8265315
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
8265264 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
8265315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 8953944 - 8953878
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||| |||||||||||| |||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
8953944 |
ttatcctcgtgagcttaacacagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
8953878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 104 - 179
Target Start/End: Complemental strand, 14876675 - 14876601
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||||||||| |||||||| ||| || |||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtagggaaattgcatattatatgcaggagc-cggggttcgaacctcggacac |
14876601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 17027954 - 17027895
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
17027954 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccgggg |
17027895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 17558390 - 17558331
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
17558390 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagccgggg |
17558331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 157
Target Start/End: Complemental strand, 30972892 - 30972837
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||| ||||| |
|
|
| T |
30972892 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgccggagc |
30972837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 37290922 - 37290969
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
37290922 |
cccgtgagcttaacttagttgatagggatattgcatattatatgcagg |
37290969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 153
Target Start/End: Original strand, 39362260 - 39362311
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
39362260 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
39362311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 40740525 - 40740572
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
40740525 |
cccgtaagcttaactcagttgatagggatattgcatattatatgcagg |
40740572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 162
Target Start/End: Complemental strand, 2787150 - 2787096
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
2787096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 6280477 - 6280535
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggatattgaatattatatgcaggagccgggg |
6280535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 10083164 - 10083210
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
10083210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 16449122 - 16449172
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
16449122 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
16449172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 26022244 - 26022294
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
26022244 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
26022294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 26280857 - 26280799
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| |||||||| ||||| |||| |
|
|
| T |
26280857 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgccggagccgggg |
26280799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 28909462 - 28909520
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||| |||||||||| |||| |
|
|
| T |
28909462 |
atccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagccgggg |
28909520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 32719680 - 32719630
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
32719630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 35939484 - 35939534
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
35939534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 36540284 - 36540334
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
36540284 |
atccccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
36540334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 38955267 - 38955217
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| ||||||||||||||| |
|
|
| T |
38955267 |
atccccgtgagcttaactcagttggtagggatattacatattatatgcagg |
38955217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 42035333 - 42035391
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| || ||||||||||||||| |||||||| |||||||||||||| ||||||| |
|
|
| T |
42035333 |
atccccgtaagtttaactcagttgataaagatattgtatattatatgcaggggctgggg |
42035391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 169
Target Start/End: Complemental strand, 43053959 - 43053894
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
43053959 |
tatctccgtgagcttaactcagttggtagggatatttcatattatatgcaggag-tcggggttcgaa |
43053894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 43284039 - 43283981
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43284039 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
43283981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 5326243 - 5326194
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||||||||| |
|
|
| T |
5326243 |
atccccgtgagcttagctcagttggtagagatattgcattttatatgcag |
5326194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 96 - 153
Target Start/End: Complemental strand, 11962625 - 11962568
Alignment:
| Q |
96 |
gttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||| || || ||||||| |
|
|
| T |
11962625 |
gttttattatccccgtgagcttagctcagttgatagagatattgtattttgtatgcag |
11962568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 105 - 154
Target Start/End: Complemental strand, 23178963 - 23178914
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23178914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 29260615 - 29260668
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||| |||||||||||||||| || ||| |||||||||||||||||||||||| |
|
|
| T |
29260615 |
tatccacgtgagcttaactcagctggtagggatattgcatattatatgcaggag |
29260668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 107 - 156
Target Start/End: Complemental strand, 34158727 - 34158678
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
34158678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 37090686 - 37090622
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
37090686 |
atccccgtgagtttaactcagttggtagggatattgtatattatatgcaggag-tcggggttcgaa |
37090622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 38219641 - 38219577
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
38219641 |
atccccgtgagcatagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
38219577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 38402249 - 38402298
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||||| ||| ||||||||||||||| |||||| |
|
|
| T |
38402249 |
tccccgtgagcttaactcagttggtagggatattgcatattatttgcagg |
38402298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 20164275 - 20164231
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
20164275 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
20164231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 106 - 154
Target Start/End: Complemental strand, 43856453 - 43856405
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
43856453 |
ccccgtgagcttaactcagttggtagggatattgcattttatatgcagg |
43856405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 110 - 157
Target Start/End: Original strand, 6018490 - 6018537
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||| ||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
6018490 |
gtgagcttaattcagttgatggagatattgtatattatatgcaggagc |
6018537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 104 - 179
Target Start/End: Original strand, 7816400 - 7816474
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||| |||||| |||||||| ||| ||||||| ||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
7816400 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcaggagc-cggggttcgaacctcggacac |
7816474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 16432202 - 16432143
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||| |||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
16432202 |
tatctccgtgaacttagctcagttggtagggatattgcatattatatgcaggagccgggg |
16432143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 23339966 - 23339923
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
23339966 |
cccgtgagcttaactcagttggtagagatattgtatattatatg |
23339923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 110 - 157
Target Start/End: Original strand, 42006781 - 42006828
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
42006781 |
gtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
42006828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 150
Target Start/End: Original strand, 43656032 - 43656079
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
43656032 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
43656079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 112 - 154
Target Start/End: Complemental strand, 7764004 - 7763962
Alignment:
| Q |
112 |
gagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcagg |
7763962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 7797127 - 7797185
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||| |||||||| ||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
7797127 |
atccccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccgggg |
7797185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 10030409 - 10030459
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||| ||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
10030409 |
atccctgtgagtttagctcagttggtagagatattgcatattatatgcagg |
10030459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 23858198 - 23858244
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
23858198 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23858244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 112 - 162
Target Start/End: Complemental strand, 24480886 - 24480836
Alignment:
| Q |
112 |
gagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| |||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
24480886 |
gagcttatctcagttggtagagatattgtatattatatgcaggggctgggg |
24480836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 26734069 - 26734119
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||| |||||||| |||| ||||||||||||||||||||| |
|
|
| T |
26734069 |
atccccgtaagcttagctcagttggtagatatattgcatattatatgcagg |
26734119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 34894366 - 34894416
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
34894366 |
atccccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
34894416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 39587544 - 39587594
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||| |||||| |||| |
|
|
| T |
39587544 |
atccccgtgagcttagctcagttggtagagatattgcattttatattcagg |
39587594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 41616439 - 41616389
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
41616439 |
atccccgtgagcataactcagttggtagggatattgtatattatatgcagg |
41616389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 115 - 153
Target Start/End: Complemental strand, 44260251 - 44260213
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44260251 |
cttagctcagttgatagagatattgcatattatatgcag |
44260213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 179
Target Start/End: Original strand, 8969098 - 8969166
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||| || ||||| ||| ||||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
8969098 |
gtgagcttagctaagttggtaggaatattgcatattatatgcaggagct-ggggttcgaacctcggacac |
8969166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 154
Target Start/End: Original strand, 11710278 - 11710331
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| ||| ||||||||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
11710278 |
gttatccccatgaacttaactcagttgttagggatattgcatattacatgcagg |
11710331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 97 - 162
Target Start/End: Complemental strand, 22274691 - 22274626
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||| ||| |||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
22274691 |
tttttttattcccatgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
22274626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 27077173 - 27077120
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| | ||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
27077173 |
gttatctctgtgagcttagctcagttggtagggatattgcatattatatgcagg |
27077120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 29734078 - 29734014
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||| |||||||||||| || ||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
29734078 |
atccccgtgagtttaactcagttggtaaggatattgtatattatatgcaggag-tcggggttcgaa |
29734014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 112 - 153
Target Start/End: Complemental strand, 37524272 - 37524231
Alignment:
| Q |
112 |
gagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
37524272 |
gagcttagctcagttggtagagatattgcatattatatgcag |
37524231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 38620414 - 38620361
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||| ||||||||| |||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
38620414 |
atccctgtgagcttagctcagttggtagggatattgtatattatatgcaggagc |
38620361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 43186850 - 43186903
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||| |||||| ||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
43186850 |
atccgcgtgagtttagctcagttggtagggatattgcatattatatgcaggagc |
43186903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 111 - 160
Target Start/End: Original strand, 43403296 - 43403345
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||||||||| ||| ||||| |
|
|
| T |
43403296 |
tgagcttaattcagttggtagagatattgcatattatatgtaggggctgg |
43403345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 2294174 - 2294122
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||| |||| ||||||| |||||| ||||||||||||||| |
|
|
| T |
2294174 |
ttatccccgtgagtttagctcaattgatagggatattacatattatatgcagg |
2294122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 106 - 158
Target Start/End: Complemental strand, 4615747 - 4615695
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagct |
158 |
Q |
| |
|
||||||||| ||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
4615747 |
ccccgtgagtttagttcagttggtagggatattgcatattatatgcaggagct |
4615695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 122 - 162
Target Start/End: Original strand, 5038573 - 5038613
Alignment:
| Q |
122 |
cagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
5038573 |
cagttggtagggatattgcatattatatgcaggagctgggg |
5038613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 7109353 - 7109313
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
7109353 |
gcttagctcagttggtagagatattgcatattatatgcagg |
7109313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 13647514 - 13647478
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13647514 |
ctcagttggtagagatattgcatattatatgcaggag |
13647478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 13747939 - 13747903
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13747939 |
ctcagttggtagagatattgcatattatatgcaggag |
13747903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 24458312 - 24458364
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||| |||||||||||||| |
|
|
| T |
24458312 |
ttatccccgtgagcttagctcagttggaagggatattgtatattatatgcagg |
24458364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 28420499 - 28420439
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| |||||||||| |||||||| ||| |||||||||||||||||| ||||| |||| |
|
|
| T |
28420499 |
ttatcctcgtgagcttagctcagttggtaggaatattgcatattatatgctggagccgggg |
28420439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 109 - 149
Target Start/End: Original strand, 28460203 - 28460243
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
28460203 |
cgtgagcttaactcagttggtagggatattgcatattatat |
28460243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 107 - 179
Target Start/End: Original strand, 40362048 - 40362119
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||||||||||| | | |||||||||| |||| |||| |
|
|
| T |
40362048 |
cccgtgagcttagctcagttagtagggatattgcatattatatgcagg-ggtcggggttcgaacctcggacac |
40362119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 148
Target Start/End: Complemental strand, 44340418 - 44340374
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattata |
148 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggatattgcatattata |
44340374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 257535 - 257586
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
257535 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
257586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 658385 - 658334
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
658385 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
658334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 844121 - 844070
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
844121 |
tatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
844070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 3949148 - 3949109
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3949148 |
gtgagcttaactcagttggtagggatattgcatattatat |
3949109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 5332919 - 5332977
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||| |||||||| |||||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
5332919 |
gtgagcttagctcagttggtagagatattatatattatatgcaggag-tcggggttcgaa |
5332977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 7194266 - 7194317
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagccgggg |
7194317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 7765643 - 7765698
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| || |||||| |||||||||||||||||| |||| |
|
|
| T |
7765643 |
cccgtgagcttagctcagttggtatggatattacatattatatgcaggagccgggg |
7765698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 10568081 - 10568132
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| |||||||||||||| ||||||| |
|
|
| T |
10568081 |
tatccccgtgagtttagctcagttggtagggatattgcatattaaatgcagg |
10568132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 26395360 - 26395411
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
26395360 |
tatccccgtgaacttatctcagttgataaggatattgcattttatatgcagg |
26395411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 105 - 179
Target Start/End: Complemental strand, 39709260 - 39709189
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||| |||||||| || | |||||||||| ||||||||| |
|
|
| T |
39709260 |
tccccgtgagcttaacta--ttggtagagatattgcatatcatatgcagcag-ttggggttcgaacctcgtacac |
39709189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 40094885 - 40094932
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||||||||| |
|
|
| T |
40094885 |
cccgtgagcttagctcagttgataaggatattgcattttatatgcagg |
40094932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 119 - 162
Target Start/End: Original strand, 44444556 - 44444599
Alignment:
| Q |
119 |
actcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
44444556 |
actcagttggtagggatattgcatattatatgcaggggctgggg |
44444599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 3190022 - 3189972
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| || || |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3190022 |
atccccgtgtgcatagctcagttggtagggatattgcatattatatgcagg |
3189972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 5328640 - 5328590
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| || |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5328640 |
atccctgtaagcttagctcagttggtagggatattgcatattatatgcagg |
5328590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 116 - 150
Target Start/End: Complemental strand, 7671422 - 7671388
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7671422 |
ttaactcagttgatagaaatattgcatattatatg |
7671388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Complemental strand, 13773449 - 13773407
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||| |||| |
|
|
| T |
13773449 |
ctcagttggtagagatattgcatattatatgtaggagccgggg |
13773407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 14342573 - 14342527
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||||| | |||||||| |
|
|
| T |
14342573 |
ccgtgagcttaactcagttggtagagacattgcataatttatgcagg |
14342527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 17072636 - 17072586
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| | |||||| ||| ||||||||||||||||||||| |
|
|
| T |
17072636 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcagg |
17072586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 17575635 - 17575685
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| | |||||| ||| ||||||||||||||||||||| |
|
|
| T |
17575635 |
atccccgtgagcttagcacagttggtaggtatattgcatattatatgcagg |
17575685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 18452355 - 18452305
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||| ||||||| |
|
|
| T |
18452355 |
cccgtgagcttagctcagttgttaggaatattgcatattatatacaggagc |
18452305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 24296937 - 24296891
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
24296937 |
ccgtgagcttagctcagttagtagggatattgcatattatatgcagg |
24296891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 145
Target Start/End: Complemental strand, 38745353 - 38745311
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatatt |
145 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||| |
|
|
| T |
38745353 |
tatccccgtgagcttagctcagttggtagggatattgcatatt |
38745311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 42877410 - 42877360
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| || |||| |||||||| ||||||||||| |||||||||||||| |
|
|
| T |
42877410 |
atccccgcgaacttagctcagttggtagagatattgtatattatatgcagg |
42877360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 43980382 - 43980336
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
43980382 |
ccgtgagcttagttcagttgttagggatattgcatattatatgcagg |
43980336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Original strand, 1342725 - 1342766
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||| |||||||| || |||||||||| |
|
|
| T |
1342725 |
cgtgagcttaactcagttggtagagatactgtatattatatg |
1342766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 1503904 - 1503964
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| |||||||| |||||||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
1503904 |
gttatccccatgagcttagctcagttggcagggatattg-atattatatgcaggagccgggg |
1503964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 3912237 - 3912188
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||| ||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
3912237 |
atccccgtgagtttaactcggttggtaggaatattgcatattatatgcag |
3912188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 4654176 - 4654135
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
4654176 |
tgagcttagctcagttgctagggatattgcatattatatgca |
4654135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 149
Target Start/End: Original strand, 5215978 - 5216019
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5215978 |
ccgtgagtttaactcagttgatagaaatattacatattatat |
5216019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 150
Target Start/End: Complemental strand, 8698648 - 8698607
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
8698648 |
cgtgagcttagctcagttggtagggatattgcatattatatg |
8698607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 10573103 - 10573148
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
10573103 |
cgtgagtttagctcagttggtagggatattgcatattatatgcagg |
10573148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 107 - 152
Target Start/End: Complemental strand, 10587347 - 10587302
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||| |||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
10587347 |
cccgtaagcttagctcagttggtagggatattgcatattatatgca |
10587302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 106 - 179
Target Start/End: Complemental strand, 10594287 - 10594215
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||||||| | ||||| ||| |||||||||| |||||||||||||| |||||||||| | ||||||| |
|
|
| T |
10594287 |
ccccgtgagcttagtttagttggtagggatattgcattttatatgcaggagc-cggggttcgaaccccgtacac |
10594215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 107 - 179
Target Start/End: Original strand, 11483120 - 11483190
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||| || ||||||| ||| |||||||||||||||||||||||| |||||||||| |||| |||| |
|
|
| T |
11483120 |
cccgtgagcgtagctcagttagtaggaatattgcatattatatgcaggagc--ggggttcgaacctcggacac |
11483190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Original strand, 13591816 - 13591865
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||| |||| |||||||||| |
|
|
| T |
13591816 |
atccccgtgagtttaactcagttggtagggatatcgcattttatatgcag |
13591865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 161
Target Start/End: Original strand, 22202714 - 22202767
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||||||||||||||||| ||| || |||||||| | |||||||||| |||| |
|
|
| T |
22202714 |
ccgtgagcttaactcagttggtagggacattgcataatttatgcaggagttggg |
22202767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 103 - 152
Target Start/End: Original strand, 28084275 - 28084324
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||| |||||||||||||||||||||||||| | || ||| |||||||| |
|
|
| T |
28084275 |
tatcctcgtgagcttaactcagttgatagagacaatgaataatatatgca |
28084324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 2168522 - 2168470
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||| ||| |||||| |||| |
|
|
| T |
2168522 |
ttatccccgtgagcttagctcagttggtagggatattacattttatatacagg |
2168470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 8862193 - 8862149
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
8862193 |
gtgagcttagctaagttggtagggatattgcatattatatgcagg |
8862149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 9407386 - 9407438
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
9407386 |
ttatccccatgaggttaacctggttgatagggatattgcatattatatgcagg |
9407438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 153
Target Start/End: Complemental strand, 26192784 - 26192740
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
26192784 |
cgtgagcttagttcagttggtagggatattgcatattatatgcag |
26192740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 28628662 - 28628710
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||||||| |||||||| || |||||| ||||||||||||| |
|
|
| T |
28628662 |
atccccgtgagcttagctcagttggtacggatattacatattatatgca |
28628710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 33604247 - 33604196
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||| |||||| ||||||| |
|
|
| T |
33604247 |
ttatccccgtgagcttagctcagttggtagggatattg-atattacatgcagg |
33604196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 41865149 - 41865105
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| |||||||| | |||||||| ||||||||||||||| |
|
|
| T |
41865149 |
gtgagcttagctcagttggtggagatattacatattatatgcagg |
41865105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 1632507 - 1632449
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||| |||||||| ||| ||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
1632507 |
gtgagcttagctcagttggtaggaatattacatattatatgcaggag-tcggggttcgaa |
1632449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Complemental strand, 1877724 - 1877681
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||| ||| | |||||| |||||||| |
|
|
| T |
1877724 |
cgtgagcttaactcagttgatatagacaatgcataatatatgca |
1877681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 2114882 - 2114929
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||||||||||||||| |||||| | | |||||| |||||| |
|
|
| T |
2114882 |
tccccgtgagcttaactcagttggtagagacaatacatattttatgca |
2114929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 3227072 - 3227022
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||| ||||||| ||| |||||||||||||||||||||| |
|
|
| T |
3227072 |
tatccccgtgagattagttcagttggtag-gatattgcatattatatgcagg |
3227022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 5570894 - 5570941
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| | | |||||||||| ||||||||||| |
|
|
| T |
5570894 |
cccgtgagcttagctcagttggttgggatattgcatgttatatgcagg |
5570941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 99 - 150
Target Start/End: Complemental strand, 9070803 - 9070752
Alignment:
| Q |
99 |
ttgttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||| |||||||||||||||||| ||| ||||| |||| ||||||| |
|
|
| T |
9070803 |
ttgttatcctcgtgagcttaactcagttagtagggatatcgcattttatatg |
9070752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 104 - 151
Target Start/End: Complemental strand, 9187296 - 9187249
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||| |||||||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggatattacattttatatgc |
9187249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 150
Target Start/End: Complemental strand, 14582505 - 14582466
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
14582505 |
tgagtttaactcagttgttagggatattgcatattatatg |
14582466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 29729114 - 29729165
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||| ||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
29729114 |
tatccccgtgagtttagttcagttggtagggatattgcatattatatacagg |
29729165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 154
Target Start/End: Complemental strand, 32779312 - 32779269
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| || ||||||||||||||||| |||||||| |
|
|
| T |
32779312 |
tgagcttaactcaattattagagatattgcatattttatgcagg |
32779269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 108 - 179
Target Start/End: Original strand, 36918493 - 36918563
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||||||||||||||| || |||||| ||||||||||| | ||| | |||||||||| |||| |||| |
|
|
| T |
36918493 |
ccgtgagcttaactcagttggtaaggatattacatattatatgta-gaggtaggggttcgaatctcggacac |
36918563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 104 - 151
Target Start/End: Original strand, 37092088 - 37092135
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||| ||||||||||| |
|
|
| T |
37092088 |
atccccgtgagtttagctcagttggtagggatattgtatattatatgc |
37092135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 150
Target Start/End: Complemental strand, 40322937 - 40322890
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||| ||||||| |
|
|
| T |
40322937 |
tatccccgtgagcttggctcagttggtagaaatattgcattttatatg |
40322890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 3e-18; HSPs: 118)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 3766808 - 3766866
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
3766808 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
3766866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 107 - 157
Target Start/End: Complemental strand, 44593552 - 44593502
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44593552 |
cccgtgagcttaactcagttaatagagatattgcatattatatgcaggagc |
44593502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 5073262 - 5073314
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
5073262 |
ttatccccgtgagcttaactcagttggtagagatattgtatattatatgcagg |
5073314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 29617400 - 29617460
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
29617400 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
29617460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 2681091 - 2681157
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
2681091 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
2681157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 12615747 - 12615798
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
12615747 |
tatccccttgagcttaactcagttgatagggatattgcatattatatgcagg |
12615798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 15106766 - 15106700
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||| |||||||||||||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
15106766 |
ttatcccggtgagcttaactcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
15106700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 104 - 159
Target Start/End: Complemental strand, 38889566 - 38889511
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
38889566 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaggggctg |
38889511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 44616598 - 44616657
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
44616598 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
44616657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 12640662 - 12640604
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
12640604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 25833552 - 25833610
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
25833610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 103 - 169
Target Start/End: Original strand, 35950124 - 35950189
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
35950124 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
35950189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 42443686 - 42443744
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
42443686 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
42443744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 47999777 - 47999835
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
47999777 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgtaggagctgggg |
47999835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 30940764 - 30940817
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
30940764 |
tgttatccccgtgagcttagctcagttggtagtgatattgcatattatatgcag |
30940817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 108 - 157
Target Start/End: Complemental strand, 48288470 - 48288421
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
48288470 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcaggagc |
48288421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 10244964 - 10244904
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||| |||||| |||| |
|
|
| T |
10244964 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggagccgggg |
10244904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 24061404 - 24061344
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
24061404 |
ttatccccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagccgggg |
24061344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 47641040 - 47641100
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||| ||| ||||||| |
|
|
| T |
47641040 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggctgggg |
47641100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 9877341 - 9877290
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9877341 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
9877290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 15238885 - 15238936
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15238885 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
15238936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 161
Target Start/End: Original strand, 15694545 - 15694604
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||| |||||||||||||| |||||| |
|
|
| T |
15694545 |
ttatccccgtgagcttaattcagttggtagggatattgtatattatatgcaggggctggg |
15694604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 102 - 161
Target Start/End: Original strand, 15701525 - 15701584
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||||||||||||||| ||||||| ||| ||||||| |||||||||||||| |||||| |
|
|
| T |
15701525 |
ttatccccgtgagcttaattcagttggtagggatattgtatattatatgcaggggctggg |
15701584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 19753042 - 19752991
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
19753042 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
19752991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 24781030 - 24781085
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
24781085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 27510327 - 27510272
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
27510272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 34267621 - 34267566
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
34267621 |
cccgtgagcttagctcagttggtaggaatattgcatattatatgcaggagctgggg |
34267566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 47255152 - 47255097
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| ||||||||| |||| |
|
|
| T |
47255152 |
cccgtgagcttaactcagttggcagagatattgcatattatctgcaggagccgggg |
47255097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 2228972 - 2229022
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2228972 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
2229022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 9712267 - 9712221
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
9712221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 23102631 - 23102581
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
23102581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 28444155 - 28444105
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
28444155 |
atccccgtgagcttaactcagttggtagagatatcgcattttatatgcagg |
28444105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 103 - 153
Target Start/End: Original strand, 29625917 - 29625967
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||| ||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
29625917 |
tatccacgtgagcttaactcagttggtagggatattgcatattatatgcag |
29625967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 31026216 - 31026274
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
31026216 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccgggg |
31026274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 32619347 - 32619405
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||| |||||| |||| |
|
|
| T |
32619347 |
atccccgtgagcttaactcagttgttaaggatattgcatattatatgtaggagccgggg |
32619405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 162
Target Start/End: Original strand, 36174391 - 36174445
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
36174445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 107 - 169
Target Start/End: Complemental strand, 36391974 - 36391913
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
36391913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 105 - 150
Target Start/End: Original strand, 3392465 - 3392510
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3392465 |
tccccgtgagcttaactcagttgatatggatattgcatattatatg |
3392510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 12772112 - 12772176
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
12772112 |
atcctcgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
12772176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 109 - 162
Target Start/End: Original strand, 36720109 - 36720162
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||| |||||||| ||| ||||||||||||||||| |||||||||||| |
|
|
| T |
36720109 |
cgtgagcttagctcagttggtagggatattgcatattatatacaggagctgggg |
36720162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 38824705 - 38824648
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||| ||||||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
38824705 |
tttttttatctccgtgagcttagctcagttgatagggatattgcgtattatatgcagg |
38824648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 46534821 - 46534768
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||| |||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
46534821 |
atccccatgagcttagctcagttggtagggatattgcatattatatgcaggagc |
46534768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 36469780 - 36469720
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||| ||||||| |||||||||| |||| |
|
|
| T |
36469780 |
ttatccccgtgagcttagctcagttggtagggatattacatattacatgcaggagccgggg |
36469720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 44377112 - 44377068
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
44377112 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
44377068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 44385979 - 44385935
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
44385979 |
gtgagcttaactcagttggtagagatattacatattatatgcagg |
44385935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 103 - 179
Target Start/End: Original strand, 47463927 - 47464002
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||| |||||||||||||||||||| |||| ||||||||| ||||||||||| | | |||||||||| |||| |||| |
|
|
| T |
47463927 |
tatcaccgtgagcttaactcagttggtagaaatattgcatgttatatgcagg-ggttggggttcgaacctcggacac |
47464002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 5990219 - 5990168
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||| |||||||||||||| |
|
|
| T |
5990219 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgcagg |
5990168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 9233836 - 9233785
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||| || ||||||||||| |
|
|
| T |
9233836 |
tatccccgtgagcttaactcagttggtagggatattgaattttatatgcagg |
9233785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 18223787 - 18223744
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
18223787 |
cccgtgagcttaactcagttggtagggatattgcatattatatg |
18223744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 27704373 - 27704322
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27704373 |
tatccccgtgaacttaactcagttggtaggaatattgcatattatatgcagg |
27704322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 32677008 - 32676957
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
32676957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 40200179 - 40200132
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
40200179 |
cccgtaagcttaactcagttggtagaaatattgcatattatatgcagg |
40200132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 21388520 - 21388578
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| ||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
21388520 |
atccccatgagcgtagctcagttggtagggatattgcatattatatgcaggagccgggg |
21388578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 27424836 - 27424886
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
27424836 |
atccccgtgagcttagctcagttggaagggatattgcatattatatgcagg |
27424886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 145
Target Start/End: Complemental strand, 29281413 - 29281375
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatatt |
145 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29281413 |
cccgtgagcttaactcagttgatagggatattgcatatt |
29281375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 30806112 - 30806162
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30806112 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcagg |
30806162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 37300172 - 37300126
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
37300172 |
atccccgtgagcttagctcagttggtagggatattgcatattatatg |
37300126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 41084040 - 41084086
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
41084040 |
ccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
41084086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 112 - 154
Target Start/End: Complemental strand, 41913829 - 41913787
Alignment:
| Q |
112 |
gagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
41913829 |
gagcttagctcagttgatagagatattgcattttatatgcagg |
41913787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 42182267 - 42182221
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
42182267 |
ccgtgagcttaactcagttggtaggggtattgcatattatatgcagg |
42182221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 48447746 - 48447796
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||| |||| ||||||||||| |
|
|
| T |
48447746 |
atcctcgtgagcttaactcagttggtagagatatcgcattttatatgcagg |
48447796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 24692471 - 24692524
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||| ||| |||||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
24692471 |
tatccccgtgaggttagctcagttggtagggatattgcatattctatgcaggag |
24692524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 109 - 154
Target Start/End: Complemental strand, 30388575 - 30388530
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcatattatatgcagg |
30388530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 33996954 - 33996890
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||| || |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
33996954 |
atccccgtgagtatagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
33996890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 162
Target Start/End: Original strand, 35645593 - 35645654
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||| ||||| || |||||||| ||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
35645593 |
gttatccccatgagcgtagctcagttggtagggatattgtatattatatgcaggagccgggg |
35645654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 36114414 - 36114365
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||| |||||||||||||| |||| | ||||||||||||||||||| |
|
|
| T |
36114414 |
atccccgtaagcttaactcagttaataggggtattgcatattatatgcag |
36114365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 105 - 162
Target Start/End: Complemental strand, 45640164 - 45640107
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||| ||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
45640164 |
tccccgtgagcttaacttagttagtagggatattgtatattatatgcaggaactgggg |
45640107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 110 - 159
Target Start/End: Complemental strand, 48413993 - 48413944
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||| |||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
48413993 |
gtgagcttagctcaattggcagagatattgcatattatatgcaggagctg |
48413944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 13730164 - 13730120
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
13730164 |
gtgagcttagcttagttggtagagatattgcatattatatgcagg |
13730120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 24880527 - 24880467
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||| |||| |||||| |||||||| ||| ||||||| ||||||||||||||||| |||| |
|
|
| T |
24880527 |
ttatctccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccgggg |
24880467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 104 - 152
Target Start/End: Complemental strand, 27679083 - 27679035
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| ||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
27679083 |
atcctcgtgagcttaactcagttggtatggatattgcatattatatgca |
27679035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 32074470 - 32074410
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||| ||| ||||||||||| ||||||| |
|
|
| T |
32074470 |
ttatccccgtgagcttagctcagttggtagggatatcacattttatatgcaggggctgggg |
32074410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 35815833 - 35815885
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
35815833 |
ttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
35815885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 154
Target Start/End: Complemental strand, 37327097 - 37327053
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||| |
|
|
| T |
37327097 |
gtgagcttaattcagttgacagagatattgtatattatatgcagg |
37327053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 3529776 - 3529827
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||||||| ||| |||||||||| |||||| |||| |
|
|
| T |
3529776 |
tatccccgtgagtttaactcagttggtagggatattgcattttatatacagg |
3529827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 153
Target Start/End: Complemental strand, 4232409 - 4232366
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
4232409 |
gtgaggttaactcaattggtagagatattgcatattatatgcag |
4232366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 108 - 155
Target Start/End: Complemental strand, 7401456 - 7401409
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
||||||| |||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
7401456 |
ccgtgagtttaactcagttggtagggatattgtatattatatgcagga |
7401409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 21177705 - 21177666
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
21177705 |
gtgagcttaactcaattgatagggatattgcatattatat |
21177666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 21762966 - 21762915
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| |||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
21762966 |
tatccccgtgaacttatctcagttggtaaggatattgcatattatatgcagg |
21762915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 26801803 - 26801744
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
26801803 |
tatccccgtgagtatagctcagttggtaggaatattgcatattatatgcaggagccgggg |
26801744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 31191670 - 31191623
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| ||||||| || |||||||||||||||||||||| |
|
|
| T |
31191670 |
cccgtgagcttaattcagttggtaaggatattgcatattatatgcagg |
31191623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 36389740 - 36389689
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||| || ||||||||||| |
|
|
| T |
36389740 |
tatccccgtgagcttagctcagttggtagggatattgtattttatatgcagg |
36389689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 41465834 - 41465881
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
41465834 |
cccgtaagcttagctcagttggtagggatattgcatattatatgcagg |
41465881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 48119466 - 48119517
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| ||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
48119466 |
tatccctgtgagcttagctcagttggtagggatattgcattttatatgcagg |
48119517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 4960788 - 4960845
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||| ||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcaggag-tcggggttcgaa |
4960845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Original strand, 8174129 - 8174171
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
8174129 |
ctcagttggtagggatattgcattttatatgcaggagctgggg |
8174171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 153
Target Start/End: Complemental strand, 9929978 - 9929928
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||| |||||| |||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
9929978 |
tatccccgttagcttagctcagttggtagggatattgaatattatatgcag |
9929928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 149
Target Start/End: Original strand, 12364745 - 12364791
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||||||||||||| ||| ||| ||||||| ||||||||| |
|
|
| T |
12364745 |
tatccccgtgagcttaactcacttggtagggatattgtatattatat |
12364791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 154
Target Start/End: Complemental strand, 15074959 - 15074925
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
15074959 |
ctcagttgatagggatattgcatattatatgcagg |
15074925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 19922169 - 19922123
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| || ||||||||| |||||||||| ||||||| |
|
|
| T |
19922169 |
atccccgtgagcttagcttagttgatagggatattgcattttatatg |
19922123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 21066883 - 21066929
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||| ||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
21066883 |
atccccgtgagtttagctcagttggtagggatattgcatattatatg |
21066929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 148
Target Start/End: Original strand, 28735731 - 28735769
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattata |
148 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
28735731 |
gtgagcttaactcagttggtagggatattgcatattata |
28735769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 156
Target Start/End: Complemental strand, 32984284 - 32984238
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||| |||||||| ||| ||||||||||||||||| |||||| |
|
|
| T |
32984284 |
gtgagcttagctcagttggtagggatattgcatattatatacaggag |
32984238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 43624467 - 43624521
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||| ||||| | ||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
43624467 |
ttattcccgttaacttaactcatttgataggaatattgcatattatatgcaggag |
43624521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 112 - 162
Target Start/End: Complemental strand, 43633155 - 43633105
Alignment:
| Q |
112 |
gagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| |||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
43633155 |
gagcttagctcagttgatagggatattatatattatatgcaggagccgggg |
43633105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 154
Target Start/End: Complemental strand, 48674631 - 48674585
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
48674631 |
ccgtgagtttaactcagttgataaggatattgcattttatatgcagg |
48674585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 154
Target Start/End: Complemental strand, 1398967 - 1398926
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| | | |||||||||||||||||||||| |
|
|
| T |
1398967 |
agcttaactcagttggttgggatattgcatattatatgcagg |
1398926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 115 - 156
Target Start/End: Original strand, 11654176 - 11654217
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
11654176 |
cttaactcaattggtagagatatttcatattatatgcaggag |
11654217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 103 - 152
Target Start/End: Original strand, 39098132 - 39098181
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||| ||||||||| ||||||| ||| |||||||||||||||||||| |
|
|
| T |
39098132 |
tatccctgtgagcttagttcagttggtagggatattgcatattatatgca |
39098181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 160
Target Start/End: Original strand, 10226672 - 10226728
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
||||||||||| ||| ||||||| ||| ||| |||||||||||||||||| ||||| |
|
|
| T |
10226672 |
atccccgtgagtttagttcagttggtagggatgttgcatattatatgcaggggctgg |
10226728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 23755088 - 23755032
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||||||| |||| | | ||| ||||||||||||| |||||||| |||| |
|
|
| T |
23755088 |
tatccccgtgagcttagctcaatcggtagggatattgcatattttatgcaggggctg |
23755032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 24732618 - 24732578
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
24732618 |
gtgagcttagctcagttgttagggatattgcatattatatg |
24732578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 31769568 - 31769521
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
31769568 |
tcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
31769521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 98 - 150
Target Start/End: Original strand, 34000250 - 34000302
Alignment:
| Q |
98 |
tttgttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| |||| |||||| |||||| |
|
|
| T |
34000250 |
tttgttgtctccgtgagcttaactcagttgataaggataatgcataatatatg |
34000302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 121 - 161
Target Start/End: Complemental strand, 34051930 - 34051890
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
34051930 |
tcagttggtagtgatattgcatattatatgcaggggctggg |
34051890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 104 - 152
Target Start/End: Original strand, 36622171 - 36622219
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||| |||| |||| ||| ||| |||||||||||||||||||| |
|
|
| T |
36622171 |
atccccgtgaacttagctcaattggtagggatattgcatattatatgca |
36622219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 151
Target Start/End: Complemental strand, 42798386 - 42798342
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
|||||||||||||| ||||| ||| ||||||||||||||||||| |
|
|
| T |
42798386 |
cccgtgagcttaacccagtttgtagggatattgcatattatatgc |
42798342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 109 - 152
Target Start/End: Original strand, 3948053 - 3948096
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||| ||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
3948053 |
cgtgagtttaactcagttgatagagacaatgcataatatatgca |
3948096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 5833037 - 5833084
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||| |||||| |||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
5833084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 12264050 - 12264101
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||| |||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
12264050 |
tatctccgtgaacttagctcagttggtagggatattgcattttatatgcagg |
12264101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 150
Target Start/End: Complemental strand, 24062081 - 24062038
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||| ||||||| ||| |||||||||||||||||| |
|
|
| T |
24062081 |
cccgtgagcttagctcagttagtagggatattgcatattatatg |
24062038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Complemental strand, 26816730 - 26816683
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||| |||||||| ||| |||| |||||| |||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggataatgcataatatatgca |
26816683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 28805304 - 28805347
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||| ||||||||| |
|
|
| T |
28805304 |
tgagcttagctcagttggtagggatattgcatatcatatgcagg |
28805347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 31170265 - 31170226
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
31170265 |
gtgagtttagctcagttgatagagatattgcataatatat |
31170226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 110 - 149
Target Start/End: Complemental strand, 32250436 - 32250397
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
32250436 |
gtgagcttggctcagttgaaagagatattgcatattatat |
32250397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 35683197 - 35683150
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
35683150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 38911294 - 38911341
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||||||| ||| | || ||| |||||||| |
|
|
| T |
38911294 |
tccccgtgagcttaactcagttgataaagacaatgtataatatatgca |
38911341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 115 - 162
Target Start/End: Original strand, 48719807 - 48719854
Alignment:
| Q |
115 |
cttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
48719807 |
cttagctcagttggtaggaatattgcatattatatgcaggagccgggg |
48719854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 3e-18; HSPs: 122)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 6518849 - 6518791
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
6518791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 21918049 - 21918107
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
21918107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 32423555 - 32423620
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
32423555 |
ttttgtcatccccgtgagcttaactcagttgttagggatattgtatattatatgcaggggctgggg |
32423620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 988711 - 988770
Alignment:
| Q |
104 |
atccccgtgagcttaactcagtt-gatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||||||||| | ||| |||||||||||||||||||||||||||||| |
|
|
| T |
988711 |
atccccgtgagcttaactcagtttggtagggatattgcatattatatgcaggagctgggg |
988770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 4417759 - 4417700
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
4417759 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
4417700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 11897243 - 11897309
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
11897243 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
11897309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 103 - 157
Target Start/End: Original strand, 1743123 - 1743177
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
1743123 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
1743177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 5900289 - 5900339
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
5900289 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
5900339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 9835030 - 9835088
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
9835088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 12463753 - 12463811
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
12463811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 24132934 - 24132984
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24132934 |
atccccgtgagcttagctcagttgatagagatattgcgtattatatgcagg |
24132984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 32505685 - 32505743
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
32505743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 41179876 - 41179818
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
41179818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 43; E-Value: 8e-16
Query Start/End: Original strand, 102 - 156
Target Start/End: Original strand, 42320312 - 42320366
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
42320312 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
42320366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 100 - 153
Target Start/End: Original strand, 16603391 - 16603444
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
16603391 |
tgttatccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
16603444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 103 - 156
Target Start/End: Original strand, 27765253 - 27765306
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
27765253 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag |
27765306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 40091474 - 40091527
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
40091474 |
atccccgtgagcttaactcagttggtagggatattgcatattatatgcaagagc |
40091527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 8968744 - 8968804
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||| ||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
8968744 |
ttatctccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
8968804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 9125658 - 9125710
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
9125658 |
ttatccccgtgagcttagctcagttggtagcgatattgcatattatatgcagg |
9125710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 106 - 162
Target Start/End: Complemental strand, 11188753 - 11188697
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
11188753 |
ccccgtgagcttagctcagttgataggaatattgcatattatatgcaggggctgggg |
11188697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 39886287 - 39886227
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||| || |||||||| ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
39886287 |
ttatccccgtgagcatagctcagttggtagggatattgcatattatatgtaggagctgggg |
39886227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 14641179 - 14641124
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| ||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
14641179 |
cccgtgagcttaactcaattggtagggatattgcatattatatgcaggagccgggg |
14641124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 104 - 179
Target Start/End: Original strand, 15241393 - 15241467
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||||||| | | |||||||||| |||| |||| |
|
|
| T |
15241393 |
atccccgtgagcttagctcagttgataggaatattgcatattatatgcagg-ggtcggggttcgaacctcggacac |
15241467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 111 - 162
Target Start/End: Complemental strand, 16386807 - 16386756
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
16386807 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctgggg |
16386756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 17545246 - 17545195
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
17545246 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
17545195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 25648159 - 25648100
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||| |||||||||| |||| |
|
|
| T |
25648159 |
tatccccgtgagcttagctcagttggtagggatattgcatattacatgcaggagccgggg |
25648100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 33736088 - 33736037
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
33736088 |
tatccccgggagcttaactcagttggtagggatattgcatattatatgcagg |
33736037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 35515512 - 35515567
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
35515567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 39919167 - 39919108
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
39919167 |
tatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccgggg |
39919108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 41930105 - 41930160
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||| ||||||||||| ||||||| |
|
|
| T |
41930105 |
cccgtgaacttaactcagttgatagggatattgcattttatatgcaggggctgggg |
41930160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 546803 - 546849
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
546803 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
546849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 1269240 - 1269190
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||| ||| |||||||||||||||||||||||||| |
|
|
| T |
1269240 |
atccccgtgagcttagctcaattggtagagatattgcatattatatgcagg |
1269190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 2328589 - 2328647
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||| || ||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
2328589 |
atccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccgggg |
2328647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 5966826 - 5966884
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
5966826 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccgggg |
5966884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 10241726 - 10241772
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
10241726 |
ccgtgagcttaactcagttggtagggatattgcatattatatgcagg |
10241772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 107 - 169
Target Start/End: Original strand, 18755986 - 18756047
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| ||||||||||||| | |||||||||| |
|
|
| T |
18755986 |
cccgtgagcttaactcagttggtagagatatcgcattttatatgcaggag-tcggggttcgaa |
18756047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Original strand, 42525397 - 42525455
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| ||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
42525397 |
atccccgtgagtttagctcagttggtagggatattgcatattatatgcaggagccgggg |
42525455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 2362971 - 2363016
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
2362971 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
2363016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 6414070 - 6414115
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
6414070 |
cgtgagcttaactcagttggtagggatattgcatattatatgcagg |
6414115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 103 - 160
Target Start/End: Original strand, 6526046 - 6526103
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgg |
160 |
Q |
| |
|
|||||||||||| ||| |||||||| ||||||||||| |||||||||||||| ||||| |
|
|
| T |
6526046 |
tatccccgtgagtttagctcagttggtagagatattggatattatatgcaggggctgg |
6526103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 12767961 - 12768014
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
12767961 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggagc |
12768014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 36888468 - 36888404
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
36888468 |
atccccgtgagcttagttcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
36888404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 106 - 162
Target Start/End: Complemental strand, 4745947 - 4745891
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||||||| |||||| |||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgaaggagccgggg |
4745891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 103 - 159
Target Start/End: Complemental strand, 11786134 - 11786078
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||| |||||||||||||||||||| ||| |||||||||| ||||||||||| |||| |
|
|
| T |
11786134 |
tatctccgtgagcttaactcagttggtagggatattgcattttatatgcaggggctg |
11786078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 13622021 - 13621969
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
13622021 |
ttatccccgtgagcttagctcagttggtagggatatcgcatattatatgcagg |
13621969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 17064933 - 17064881
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
17064933 |
ttatcctcgtgagcttaactcaattggtagggatattgcatattatatgcagg |
17064881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 21749450 - 21749398
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
21749450 |
atccccgtgagcttagctcagttggtagggatactgcatattatatgcaggag |
21749398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 36124394 - 36124446
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| ||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
36124394 |
ttatctccgtgagcttagctcagttgataggaatattgcatattatatgcagg |
36124446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 41477433 - 41477373
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| ||||||| |
|
|
| T |
41477433 |
ttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcaggggctgggg |
41477373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 102 - 153
Target Start/End: Complemental strand, 3712141 - 3712090
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
|||||||||| |||||| |||||||| |||||||||||||| |||||||||| |
|
|
| T |
3712141 |
ttatccccgtaagcttagctcagttggtagagatattgcattttatatgcag |
3712090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 6558797 - 6558848
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
6558797 |
tatccccgtgagcttagctcaattggtagggatattgcatattatatgcagg |
6558848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 11774533 - 11774474
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||||||| |||| ||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
11774533 |
tatccccgtgaccttagctcagtttgtagggatattgcatattatatgcaggagccgggg |
11774474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 150
Target Start/End: Original strand, 12891553 - 12891600
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
12891553 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatg |
12891600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Original strand, 16971618 - 16971669
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |||||||| ||||| |
|
|
| T |
16971618 |
tatccccgtgagcttagctcagttggtagagatattgtatattataggcagg |
16971669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 106 - 153
Target Start/End: Complemental strand, 25472654 - 25472607
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggatattgcatattatatgcag |
25472607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 35113032 - 35112985
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
35113032 |
cccgtgagcttagttcagttgatagggatattgcatattatatgcagg |
35112985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 36270739 - 36270786
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||| |||||| |
|
|
| T |
36270739 |
tccccgtgagcttaactcagttgatagaaacattgcatattttatgca |
36270786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 39165013 - 39165072
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||| ||| ||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
39165013 |
tatctccgtgagtttagttcagttggtagggatattgcatattatatgcaggagctgggg |
39165072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 111 - 162
Target Start/End: Original strand, 41156332 - 41156383
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
41156332 |
tgagcttagctcggttgatagggatattgcatattatatgcaggagccgggg |
41156383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 107 - 162
Target Start/End: Original strand, 43580878 - 43580933
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
||||||| |||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
43580878 |
cccgtgaacttagctcagttggtagggatattgcatattatatgcaggagccgggg |
43580933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 102 - 152
Target Start/End: Original strand, 8241045 - 8241095
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||| |||||||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
8241045 |
ttatccccatgagcttagctcagttggtagggatattgcatattatatgca |
8241095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 157
Target Start/End: Complemental strand, 11815683 - 11815629
Alignment:
| Q |
104 |
atccccgtgagctta-actcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||||||| |||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
11815683 |
atccccgtgaacttacactcagttgaaagggatattgcatattatatgcaggagc |
11815629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 18815345 - 18815395
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| || |||||||||||||||||||||| |
|
|
| T |
18815345 |
atccccgtgagcttagctcagttggtaaggatattgcatattatatgcagg |
18815395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 100 - 154
Target Start/End: Complemental strand, 19891503 - 19891449
Alignment:
| Q |
100 |
tgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| ||||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
19891503 |
tgttatcctcgtgagcttaactcagttggtaaggatattgcattttatatgcagg |
19891449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 21962178 - 21962120
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||| ||||||||| ||||| |||| |
|
|
| T |
21962178 |
atccccgtgagcttaactcagttggcagggatattgcaaattatatgcgggagccgggg |
21962120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 150
Target Start/End: Original strand, 26912830 - 26912876
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||||| ||| ||| |||||||||||||||||| |
|
|
| T |
26912830 |
atccccgtgagcttaactcaattggtagggatattgcatattatatg |
26912876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 31074200 - 31074142
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||| ||| ||||||| |||||| |||| |
|
|
| T |
31074200 |
atccccgtgagcttaactcagttggtagggatattacattttatatgtaggagccgggg |
31074142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 108 - 154
Target Start/End: Original strand, 35241397 - 35241443
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
35241397 |
ccgtgagcttagttcagttggtagagatattgcatattatatgcagg |
35241443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 40081875 - 40081925
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
40081875 |
atccccgtgagcttagctcagttggtagagatattacatcttatatgcagg |
40081925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 152
Target Start/End: Original strand, 2848209 - 2848258
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||| |||||||||||| |
|
|
| T |
2848209 |
tatccccgtgagcttagctcagttggtagggatattgtatattatatgca |
2848258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 8478968 - 8478911
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||||||||| ||| ||||||| ||| |||||||||||||||||||||| |||| |
|
|
| T |
8478968 |
ttatccccgtgagtttagttcagttggtagggatattgcatattatatgcaggggctg |
8478911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 101 - 154
Target Start/End: Complemental strand, 25729516 - 25729463
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
25729516 |
gttatccccgtgagcttagctcagttggtagggatatcgcattttatatgcagg |
25729463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 29713449 - 29713400
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||| |||||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggatattgcctattatatgcag |
29713400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 32706319 - 32706372
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||| ||||||||||| |||||| |
|
|
| T |
32706319 |
atccccgtgagcttagctcagttggtagggatattacatattatatggaggagc |
32706372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 107 - 152
Target Start/End: Original strand, 38696691 - 38696736
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||| ||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
38696691 |
cccgtaagcttaactcagttgatagggatattacatattatatgca |
38696736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 17666001 - 17666053
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
17666001 |
ttattcccgtgagcttagctcagttggtaggaatattgcatattatatgcagg |
17666053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 107 - 179
Target Start/End: Complemental strand, 23292487 - 23292416
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||| ||||||||||| | | |||||||||| |||| |||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggatattgcatgttatatgcagg-gtttggggttcgaacctcggacac |
23292416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 110 - 162
Target Start/End: Complemental strand, 25400434 - 25400382
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| || |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcatattatatgcaggagccgggg |
25400382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 42916384 - 42916436
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||| || ||||||||||| |
|
|
| T |
42916384 |
ttatccccgtgagcttagctcagttggtagggatattgtatgttatatgcagg |
42916436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 116 - 155
Target Start/End: Original strand, 4350472 - 4350511
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||| |
|
|
| T |
4350472 |
ttaactcagttgatagaaatactgcatattatatgcagga |
4350511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 105 - 179
Target Start/End: Complemental strand, 4418415 - 4418341
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagat-attgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||||||||||||||||| ||| ||| | ||||| ||||||||||| ||| |||||||||| |||| |||| |
|
|
| T |
4418415 |
tccccgtgagcttaactcagttggtagggataaatgcattttatatgcaggggct-ggggttcgaacctcggacac |
4418341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 179
Target Start/End: Complemental strand, 17175124 - 17175050
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
|||||| |||| |||||||||||| ||| |||||||||| ||||||||||| || |||||||||| |||| |||| |
|
|
| T |
17175124 |
atccccatgagtttaactcagttggtagggatattgcatgttatatgcaggggc-cggggttcgaacctcggacac |
17175050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 150
Target Start/End: Original strand, 25714327 - 25714370
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||| |||||||||| |
|
|
| T |
25714327 |
cccgtgagcttaactcagctgagagagatattgtatattatatg |
25714370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 34398460 - 34398518
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||| ||||||||||||| | |||||||||| |
|
|
| T |
34398460 |
gtgagcttaactcaattggtagagatatcgcattttatatgcaggag-tcggggttcgaa |
34398518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 35099323 - 35099276
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||||| |||||| ||||||||| ||||||||||||| |
|
|
| T |
35099323 |
cccgtgaacttaactcaattgatacagatattgcgtattatatgcagg |
35099276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 154
Target Start/End: Complemental strand, 36716924 - 36716881
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| || ||| |||||||||||||||||||||| |
|
|
| T |
36716924 |
tgagcttaactcagctggtagggatattgcatattatatgcagg |
36716881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 171
Target Start/End: Original strand, 37182540 - 37182606
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaac |
171 |
Q |
| |
|
||||||| |||||||| | ||||| ||| ||||| |||||||||||||||||| | |||||||||||| |
|
|
| T |
37182540 |
atccccgagagcttaatttagttggtagggatatcgcatattatatgcaggag-tcggggttcgaaac |
37182606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 150
Target Start/End: Original strand, 43328273 - 43328312
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
43328273 |
tgagcttaactcagttggtagagatattgtatattatatg |
43328312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 831589 - 831639
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||| |||| ||| |||||| ||||||||||||||| |
|
|
| T |
831589 |
atccccgtgagcttagctctgttggtagggatatttcatattatatgcagg |
831639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 150
Target Start/End: Original strand, 1469726 - 1469768
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
1469726 |
ccgtgagtttagctcagttggtagagatattgcatattatatg |
1469768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 150
Target Start/End: Complemental strand, 11146602 - 11146556
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||| ||||||| |
|
|
| T |
11146602 |
atccccgtgagcttagctcagttgataaggatattgcatgttatatg |
11146556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 149
Target Start/End: Complemental strand, 12365532 - 12365486
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||||| || || | ||||||||||||||||||||||||| |
|
|
| T |
12365532 |
tatccccgtgagcctagcttaattgatagagatattgcatattatat |
12365486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 146
Target Start/End: Complemental strand, 18993534 - 18993492
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatatta |
146 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||| ||||||| |
|
|
| T |
18993534 |
atccccgtgagcttagctcagttgatagggatattacatatta |
18993492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 24033074 - 24033124
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||| ||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
24033074 |
atccccgcgagcttagctcagttggtagggatattgcattttatatgcagg |
24033124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 110 - 148
Target Start/End: Complemental strand, 27301719 - 27301681
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattata |
148 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
27301719 |
gtgagcttaacttagttgacagagatattgcatattata |
27301681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 103 - 157
Target Start/End: Original strand, 27798617 - 27798671
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
|||||| |||||| || |||||||| ||| |||||||||||||||||||| |||| |
|
|
| T |
27798617 |
tatccctgtgagcatagctcagttggtagggatattgcatattatatgcaagagc |
27798671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 33433992 - 33433942
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||| |||| |||||||| |||| |||||||||||||||| |||| |
|
|
| T |
33433992 |
atccccgtgaacttagctcagttggtagaaatattgcatattatatacagg |
33433942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 154
Target Start/End: Complemental strand, 40786479 - 40786445
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40786479 |
ctcagttgatagagaaattgcatattatatgcagg |
40786445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Complemental strand, 42718878 - 42718836
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
42718878 |
ctcagttggtagggatattgcatattatatgcaggagttgggg |
42718836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 108 - 150
Target Start/End: Original strand, 42885830 - 42885872
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
42885830 |
ccgtgagcttagctaagttggtagagatattgcatattatatg |
42885872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 626812 - 626767
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||| ||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
626812 |
ccgtgagtttaactcagttagtagagatattacatattatatgcag |
626767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 105 - 154
Target Start/End: Original strand, 3198325 - 3198374
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||||| |||||||| ||| || |||||||| |||||||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtagggacattgcataatatatgcagg |
3198374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 97 - 154
Target Start/End: Complemental strand, 3515545 - 3515488
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||| |||||| ||| ||||||||| || |||||||| ||||||||||||| |
|
|
| T |
3515545 |
tttttttatcctcgtgagtttagctcagttgacagggatattgcgtattatatgcagg |
3515488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 9688745 - 9688696
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||| || |||| |||| |||||||||||||||||||| |
|
|
| T |
9688745 |
atccccgtgagcttagcttagtttgtagaaatattgcatattatatgcag |
9688696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 113 - 154
Target Start/End: Original strand, 9958583 - 9958624
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
9958583 |
agcttaacttagttgatagggatattgcatatcatatgcagg |
9958624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 111 - 156
Target Start/End: Complemental strand, 13862358 - 13862313
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||| |||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
13862358 |
tgagctcaactcaattgatagggatattgcatattatatgcgggag |
13862313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 104 - 153
Target Start/End: Complemental strand, 13876394 - 13876345
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||| || |||||| |||| ||||||||||||||| ||||||||||||| |
|
|
| T |
13876394 |
atccctgtcagcttagctcaattgatagagatattgtatattatatgcag |
13876345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 109 - 154
Target Start/End: Original strand, 20501397 - 20501442
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||||| |||||| |||||||| | |||||||| |
|
|
| T |
20501397 |
cgtgagcttaactcagttggtagagacattgcataatttatgcagg |
20501442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 102 - 151
Target Start/End: Complemental strand, 35512031 - 35511982
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgc |
151 |
Q |
| |
|
|||||||||||||||||||||||||| ||| ||||| ||| |||||||| |
|
|
| T |
35512031 |
ttatccccgtgagcttaactcagttggtagggatatcacattttatatgc |
35511982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 108 - 149
Target Start/End: Complemental strand, 42842945 - 42842904
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatat |
149 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
42842945 |
ccgtgagcttagctcagttggtagagatattgtatattatat |
42842904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 113 - 169
Target Start/End: Original strand, 10404133 - 10404188
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
|||||| |||||||| ||| ||||||||||||||||||||||| | |||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatgcaggag-tcggggttcgaa |
10404188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 102 - 154
Target Start/End: Original strand, 19985495 - 19985547
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| ||||||| |||| |||||||| ||| ||||||||||| |||||||||| |
|
|
| T |
19985495 |
ttattcccgtgaccttagctcagttggtagggatattgcataatatatgcagg |
19985547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 32389691 - 32389655
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32389691 |
ctcagttggtagagatattgcatattatatgtaggag |
32389655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 108 - 152
Target Start/End: Complemental strand, 40361648 - 40361604
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||| ||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
40361648 |
ccgtgagtttagctcagttggtagggatattgcatattatatgca |
40361604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 1670394 - 1670441
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
1670394 |
cccgtgagcttatatcagttggtagggatatggcatattatatgcagg |
1670441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 8750971 - 8750924
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||||||| | ||||| ||| |||||||||||||||||||||| |
|
|
| T |
8750971 |
cccgtgagcttagttaagttggtagggatattgcatattatatgcagg |
8750924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 10758874 - 10758819
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| |||| ||| || ||||||||||||||||||| ||| ||||||| |
|
|
| T |
10758874 |
cccgtgagtttagctcaattggtaaagatattgcatattatatgtaggggctgggg |
10758819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 123 - 150
Target Start/End: Original strand, 16424619 - 16424646
Alignment:
| Q |
123 |
agttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
16424619 |
agttgatagagatattgcatattatatg |
16424646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 105 - 152
Target Start/End: Original strand, 27679493 - 27679540
Alignment:
| Q |
105 |
tccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||||||||||||| |||||||| || ||||| |||||| |||||||| |
|
|
| T |
27679493 |
tccccgtgagcttagctcagttggtaaagataatgcataatatatgca |
27679540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 110 - 157
Target Start/End: Original strand, 29154846 - 29154893
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||| |||||||| ||| |||| ||||||||||||| |||||| |
|
|
| T |
29154846 |
gtgagcttagctcagttggtagggatagtgcatattatatgtaggagc |
29154893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 107 - 154
Target Start/End: Complemental strand, 34824577 - 34824530
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||| |||||||||||||| | |||||||||||| | ||||||||||| |
|
|
| T |
34824577 |
cccgcgagcttaactcagtcggtagagatattgcgttttatatgcagg |
34824530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 116 - 159
Target Start/End: Original strand, 38097281 - 38097324
Alignment:
| Q |
116 |
ttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |||| |
|
|
| T |
38097281 |
ttaactcagttggtatggatattgcatattatatgcaggggctg |
38097324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 97 - 162
Target Start/End: Complemental strand, 100 - 35
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| ||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
100 |
tttttttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
35 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 102 - 171
Target Start/End: Complemental strand, 266772 - 266704
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaac |
171 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
266772 |
ttatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc-cggggttcgaaac |
266704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 45; Significance: 5e-17; HSPs: 2)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 37489 - 37429
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
37489 |
ttatcctcgtgagcttaactcagttggtagggatattgcatattatatgcaggagccgggg |
37429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038; HSP #2
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 153
Target Start/End: Original strand, 23361 - 23407
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||| ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
23361 |
cccgtgaacttaactcagttggtagggatattgcatattatatgcag |
23407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 44; Significance: 2e-16; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 46522 - 46581
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
46522 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctgggg |
46581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 97 - 162
Target Start/End: Original strand, 11984 - 12049
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||| |||||| ||||| |||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
11984 |
tttttttatcctcgtgaacttagctcagttggtagggatattgcatattatatgcaggagccgggg |
12049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 44; Significance: 2e-16; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 103 - 162
Target Start/End: Original strand, 59779 - 59838
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
59779 |
tatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
59838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 108 - 159
Target Start/End: Original strand, 83626 - 83677
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctg |
159 |
Q |
| |
|
||||||| ||| ||||||| | | ||||||||||||||||||||||||||| |
|
|
| T |
83626 |
ccgtgagtttagctcagttatttgggatattgcatattatatgcaggagctg |
83677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 42; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 157
Target Start/End: Original strand, 8963 - 9016
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagc |
157 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagc |
9016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 42; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 42; E-Value: 0.000000000000003
Query Start/End: Original strand, 104 - 169
Target Start/End: Complemental strand, 4087 - 4023
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaa |
169 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcaggag-tcggggttcgaa |
4023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 107 - 155
Target Start/End: Original strand, 3666 - 3714
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagga |
155 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
3666 |
cccgtgagcttaactcagttggtagggatattgcatattatatgcagga |
3714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 102 - 150
Target Start/End: Complemental strand, 50076 - 50028
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
50076 |
ttattcccgtgagcttaactcagttgatagggatattgcatattatatg |
50028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 101 - 165
Target Start/End: Complemental strand, 8901 - 8837
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggtt |
165 |
Q |
| |
|
|||||||||||||||||| |||||||| ||| ||||||||||||| |||||||| || ||||||| |
|
|
| T |
8901 |
gttatccccgtgagcttagctcagttggtagggatattgcatattttatgcaggggccgggggtt |
8837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 40; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 107 - 162
Target Start/End: Complemental strand, 930 - 875
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccgggg |
875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 39; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 104 - 154
Target Start/End: Complemental strand, 10899 - 10849
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
10899 |
atccccgtgagcttagctcagttggtagggatattgcatattatatgcagg |
10849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 103 - 179
Target Start/End: Original strand, 396 - 471
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctgggggttcgaaactcgtacac |
179 |
Q |
| |
|
||||||||||| |||| |||| ||||||| |||||||||||||||||||||| || |||||||||| |||| |||| |
|
|
| T |
396 |
tatccccgtgaacttagctcaattgatagggatattgcatattatatgcaggggc-cggggttcgaacctcggacac |
471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1185 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: scaffold1185
Description:
Target: scaffold1185; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Complemental strand, 2446 - 2394
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
2446 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
2394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 37; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 12456 - 12508
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||||||||| || |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
12456 |
atccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggag |
12508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460; HSP #2
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 154
Target Start/End: Complemental strand, 13266 - 13226
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatgcagg |
13226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 37; Significance: 0.000000000003; HSPs: 2)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 15761 - 15813
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||| |||||||||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
15761 |
atcctcgtgagcttatctcagttggtagggatattgcatattatatgcaggag |
15813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157; HSP #2
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 113 - 152
Target Start/End: Complemental strand, 21017 - 20978
Alignment:
| Q |
113 |
agcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
||||||||||| |||||||||||| |||||| |||||||| |
|
|
| T |
21017 |
agcttaactcaattgatagagatactgcataatatatgca |
20978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 156
Target Start/End: Original strand, 1256 - 1311
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
1256 |
gttattcccgtgagcttaactcagttggtaggaatattgtatattatatgcaggag |
1311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 17335 - 17284
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
17335 |
tatccccgtgaacttaactcagttgatagggatattgcattttacatgcagg |
17284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0254 (Bit Score: 36; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0254
Description:
Target: scaffold0254; HSP #1
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 101 - 156
Target Start/End: Original strand, 1311 - 1366
Alignment:
| Q |
101 |
gttatccccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
||||| ||||||||||||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
1311 |
gttattcccgtgagcttaactcagttggtaggaatattgtatattatatgcaggag |
1366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 35; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 104 - 154
Target Start/End: Original strand, 8818 - 8868
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||| |||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
8818 |
atccccgtgagcttagctcagttggtagggatattgcattttatatgcagg |
8868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 35; Significance: 0.00000000005; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 107 - 161
Target Start/End: Complemental strand, 12331 - 12277
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcaggagctggg |
161 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||||||| ||| |||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggatattgcatattatatgcatgaggtggg |
12277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0113 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0113
Description:
Target: scaffold0113; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 108 - 153
Target Start/End: Complemental strand, 37117 - 37072
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37117 |
ccgtgagcttaactcagttgataagaatattgcatattatatgcag |
37072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0330 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0330
Description:
Target: scaffold0330; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 108 - 156
Target Start/End: Original strand, 6769 - 6817
Alignment:
| Q |
108 |
ccgtgagcttaactcagttgatagagatattgcatattatatgcaggag |
156 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||||| ||||| |
|
|
| T |
6769 |
ccgtgaacttaactcagttggtagggatattgcatattatatgtaggag |
6817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0288 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 106 - 154
Target Start/End: Original strand, 21263 - 21311
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||| || ||||| ||| |||||||||||||||||||||| |
|
|
| T |
21263 |
ccccgtgagcttagcttagttggtagggatattgcatattatatgcagg |
21311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 106 - 150
Target Start/End: Original strand, 5981 - 6025
Alignment:
| Q |
106 |
ccccgtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||||||| |||| ||||||| |||||||||||||||||| |
|
|
| T |
5981 |
ccccgtgagcttagctcatttgatagggatattgcatattatatg |
6025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 33; Significance: 0.0000000008; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 102 - 154
Target Start/End: Complemental strand, 59253 - 59201
Alignment:
| Q |
102 |
ttatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||| || ||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
59253 |
ttatcctcgcgagcttagttcagttggtagagatattgcatattatatgcagg |
59201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 154
Target Start/End: Original strand, 175 - 218
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
175 |
tgagcttagctcagttggtatagatattgcatattatatgcagg |
218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 154
Target Start/End: Complemental strand, 146 - 103
Alignment:
| Q |
111 |
tgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| |||||||| || ||||||||||||||||||||||| |
|
|
| T |
146 |
tgagcttagctcagttggtatagatattgcatattatatgcagg |
103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 104 - 147
Target Start/End: Original strand, 45881 - 45924
Alignment:
| Q |
104 |
atccccgtgagcttaactcagttgatagagatattgcatattat |
147 |
Q |
| |
|
||||||||||||||| |||||||| ||| ||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggatattgcatattat |
45924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 32; Significance: 0.000000003; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 107 - 154
Target Start/End: Original strand, 56323 - 56370
Alignment:
| Q |
107 |
cccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||||||||||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
56323 |
cccgtgagcttaactcaattggcagggatattgcatattatatgcagg |
56370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 31; Significance: 0.00000001; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Complemental strand, 11177 - 11135
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
11177 |
ctcagttggtagggatattgcatattatatgcaggagccgggg |
11135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 120 - 162
Target Start/End: Complemental strand, 21505 - 21463
Alignment:
| Q |
120 |
ctcagttgatagagatattgcatattatatgcaggagctgggg |
162 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
21505 |
ctcagttggtagggatattgcatattatatgcaggagccgggg |
21463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 121 - 154
Target Start/End: Complemental strand, 103725 - 103692
Alignment:
| Q |
121 |
tcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
103725 |
tcagttgaaagagatattgcatattatatgcagg |
103692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 114 - 154
Target Start/End: Original strand, 1871 - 1911
Alignment:
| Q |
114 |
gcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgcagg |
1911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 153
Target Start/End: Complemental strand, 8984 - 8940
Alignment:
| Q |
109 |
cgtgagcttaactcagttgatagagatattgcatattatatgcag |
153 |
Q |
| |
|
||||||| ||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
8984 |
cgtgagcataactcaattggtagggatattgcatattatatgcag |
8940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 65854 - 65814
Alignment:
| Q |
110 |
gtgagcttaactcagttgatagagatattgcatattatatg |
150 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
65854 |
gtgagcttagctcagttggtagggatattgcatattatatg |
65814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 97 - 152
Target Start/End: Original strand, 25376 - 25431
Alignment:
| Q |
97 |
ttttgttatccccgtgagcttaactcagttgatagagatattgcatattatatgca |
152 |
Q |
| |
|
|||| |||||||||||||||||||||||||| || || | |||||| |||||||| |
|
|
| T |
25376 |
tttttttatccccgtgagcttaactcagttggtaaggacaatgcataatatatgca |
25431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0085 (Bit Score: 28; Significance: 0.0000008; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 28; E-Value: 0.0000008
Query Start/End: Original strand, 103 - 154
Target Start/End: Complemental strand, 28004 - 27953
Alignment:
| Q |
103 |
tatccccgtgagcttaactcagttgatagagatattgcatattatatgcagg |
154 |
Q |
| |
|
||||| |||||||||| ||| |||| ||| |||||||||| ||||||||||| |
|
|
| T |
28004 |
tatcctcgtgagcttagctcggttggtagggatattgcattttatatgcagg |
27953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University