View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-7 (Length: 164)
Name: Solexa-NF5880-7
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 8 - 164
Target Start/End: Original strand, 5079904 - 5080060
Alignment:
| Q |
8 |
aaaaagactaccaaaaacccatgtgatccggtgtttgtttggtcacattgagagtgaagctcnnnnnnncttgtggggctttcatctttgtgtcacaaac |
107 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5079904 |
aaaaagactaacaaaaacccatgtgatccggtgtttgtttggtcacattgagagtgaagctcaaaaaaacttgtggggctttcatctttgtgtcacaaac |
5080003 |
T |
 |
| Q |
108 |
aacaatggaaaatgatgcttgtttgcatgttaccccctcgtgggaatatcgtaccct |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5080004 |
aacaatggaaaatgatgcttgtttgcatgttaccccctcgtgggaatatcgtaccct |
5080060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University