View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-8 (Length: 162)
Name: Solexa-NF5880-8
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 4855605 - 4855735
Alignment:
| Q |
8 |
gttcattgcactgagagtttgttatgcttgaaaggtttgtgatgcttgttgtctttagttgcaagggtagtggtcagtgaatctattcgtgttgacggct |
107 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| | |
|
|
| T |
4855605 |
gttcattgcagtgagagtttgttatgtttgaaaggtttgtgatgcttgttgtctttagttgcaggggtagtggtcagtgaatctattcgtgttgacggtt |
4855704 |
T |
|
| Q |
108 |
ggctcgtacgccacttaaaaaaacgagttaa |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
4855705 |
ggctcgtacgccacttaaaaaaacgagttaa |
4855735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University