View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5880-9 (Length: 153)
Name: Solexa-NF5880-9
Description: NF5880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5880-9 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 78 - 153
Target Start/End: Complemental strand, 2042088 - 2042013
Alignment:
| Q |
78 |
ggtaaatgagactttgaaccaaggaattgatcttaattagtctaactagctaatttatcgtgatcatagaatatta |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2042088 |
ggtaaatgagactttgaaccaaggaattgatcttaattagtctaactagctaatttatcgtgatcatagaatatta |
2042013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 2042128 - 2042074
Alignment:
| Q |
10 |
gatgacatttgttcacctaagaaattgaaggtctttgttaggtaaatgagacttt |
64 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2042128 |
gatggcatttgttcacctaagaaattgaaggtctttgttaggtaaatgagacttt |
2042074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University