View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-19 (Length: 151)
Name: Solexa-NF5886-19
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-19 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 7 - 151
Target Start/End: Original strand, 16401864 - 16402008
Alignment:
| Q |
7 |
agctgataatgcatatttatgtagaaaatgtgacaatttagttcatcaagccaattttttggcacttagacatgtacggtgttttttgtgcaacacttgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16401864 |
agctgataatgcatatttatgtagaaaatgtgacaatttggttcacaaagccaattttttggcacttagacatgtacggtgttttttgtgcaacacttgt |
16401963 |
T |
|
| Q |
107 |
caaaatcttactagaagatgtcccattggagcttcactagagatc |
151 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16401964 |
caaaatcttactagaagatgtctcattggagcttcactagagatc |
16402008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 9e-19; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 9e-19
Query Start/End: Original strand, 7 - 150
Target Start/End: Complemental strand, 37507406 - 37507263
Alignment:
| Q |
7 |
agctgataatgcatatttatgtagaaaatgtgacaatttagttcatcaagccaattttttggcacttagacatgtacggtgttttttgtgcaacacttgt |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||| |||| |||||||| || || || ||| | |||| ||| | |||||||| ||| |
|
|
| T |
37507406 |
agctgatgatgcatatttatgtagaaaatgtgacaaaaaggttcatgaagcaaattttttagccctaaggcatattaggtgctttctttgcaacacatgt |
37507307 |
T |
|
| Q |
107 |
caaaatcttactagaagatgtcccattggagcttcactagagat |
150 |
Q |
| |
|
||||||||||| ||||||| || |||||||| ||| ||||||| |
|
|
| T |
37507306 |
caaaatcttacaagaagatatcttattggagcctcagtagagat |
37507263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University