View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-21 (Length: 143)
Name: Solexa-NF5886-21
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 2e-41; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 2e-41
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 31197989 - 31197870
Alignment:
| Q |
1 |
cacagacactacatttcgcttttctgctcaaatggaaacattacagtgtcaacta-------atttgaacaaaaatttaatttgacagagctaggccatt |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
31197989 |
cacagacactacatttcgcttttctgctcaaatggaaacattacagtgtcaactatcaactaatttgaacaaaaatttaatttgacaaagctaggccatt |
31197890 |
T |
 |
| Q |
94 |
tgtacataaggttattcctt |
113 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31197889 |
agtacataaggttattcctt |
31197870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University