View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-24 (Length: 143)
Name: Solexa-NF5886-24
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 5e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 903300 - 903183
Alignment:
| Q |
1 |
gagaagaattgagtaattgagtgatttagtaccttggacaaagaatatctcttattcctctggccttttttcactcttaacggacacagtagggtagggt |
100 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
903300 |
gagaagaattgggtaattgagtgctttagtaccttggacaaagaatatctcttattcctctggccttttttcactcttaacggacacactagggtagggt |
903201 |
T |
 |
| Q |
101 |
tgtcccatttgtatgaca |
118 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
903200 |
tgttccatttgtatgaca |
903183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University