View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-26 (Length: 141)
Name: Solexa-NF5886-26
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-26 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 2 - 141
Target Start/End: Original strand, 26940900 - 26941039
Alignment:
| Q |
2 |
agagacaaaccagttttgtacacgattggattagataatgtggaattttccagctataacaagtgtacaagaacacatgttctgtagtgttactagtatc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26940900 |
agagacaaaccagttttgtacacgattggattagataatgtggaattttccagctataacaagtgtacaagaacacatgttctgtagtgttactagtatc |
26940999 |
T |
 |
| Q |
102 |
tttcccgtgaacctgaatgtcacttacaactctcacgtca |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26941000 |
tttcccgtgaacctgaatgtcacttacaactctcacgtca |
26941039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University