View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-32 (Length: 140)
Name: Solexa-NF5886-32
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-32 |
 | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 17982377 - 17982268
Alignment:
| Q |
1 |
cagagacaacggggtactttaagaaaagattcaccagtttagtttttatttaatgatgtaaaatactaatatatttttcctgtgcaaaataaaaataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17982377 |
cagagacaacggggtactttaagaaaagattcaccagtttagtttttaattaatgatgtaaaatactaatatatttttcgtgtgcaaaataaaaataatt |
17982278 |
T |
|
| Q |
101 |
tgaatccctc |
110 |
Q |
| |
|
||||| |||| |
|
|
| T |
17982277 |
tgaattcctc |
17982268 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0012 (Bit Score: 92; Significance: 4e-45; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 92; E-Value: 4e-45
Query Start/End: Original strand, 1 - 104
Target Start/End: Complemental strand, 183959 - 183856
Alignment:
| Q |
1 |
cagagacaacggggtactttaagaaaagattcaccagtttagtttttatttaatgatgtaaaatactaatatatttttcctgtgcaaaataaaaataatt |
100 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
183959 |
cagagacagcggggtacttttagaaaagattcaccagtttagtttttatttaatgatgtaaaatactaatatatttttcgtgtgcaaaataaaaataatt |
183860 |
T |
|
| Q |
101 |
tgaa |
104 |
Q |
| |
|
|||| |
|
|
| T |
183859 |
tgaa |
183856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University