View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-34 (Length: 139)
Name: Solexa-NF5886-34
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-34 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 46; Significance: 1e-17; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 65 - 118
Target Start/End: Original strand, 902008 - 902061
Alignment:
| Q |
65 |
gggtattataatacctgcatttaaaataaggtacttcgtatgatccatccttgt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
902008 |
gggtattataatacctgcatttaaaataaggtactttgtatgatccattcttgt |
902061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University