View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-45 (Length: 128)
Name: Solexa-NF5886-45
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 112; Significance: 5e-57; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 112; E-Value: 5e-57
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 38264090 - 38264209
Alignment:
| Q |
8 |
ctctatatcgcttaacaaggggttctgattcgaattcagccctgaaaatagtgttaaatttcccgagggagaggattaatataggcacttccgcgcagag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
38264090 |
ctctatatcgcttaacaaggggttctgattcgaattcagccctgaaaatagtgttaaatttcccgagggagaggattaatatcggcatttccgcgcagag |
38264189 |
T |
|
| Q |
108 |
gatacttgattcacaacaaa |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38264190 |
gatacttgattcacaacaaa |
38264209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University