View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-48 (Length: 127)
Name: Solexa-NF5886-48
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-48 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 36563305 - 36563419
Alignment:
| Q |
10 |
ttgacctgacaatctctatgactatgagttcataggttgcttagccaactggtatgcgcacaccaatggaaatgttgggctcatcatattgggactgctt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36563305 |
ttgacatgacaatctctatgactatgagttcataggttgcttagccaactggtatgcgcacaccaatggaaatgttgggc---tcatattgggactgctt |
36563401 |
T |
|
| Q |
110 |
attgcttcatgtccctgt |
127 |
Q |
| |
|
|||| ||||||||||||| |
|
|
| T |
36563402 |
attgtttcatgtccctgt |
36563419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University