View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-56 (Length: 122)
Name: Solexa-NF5886-56
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-56 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 8 - 122
Target Start/End: Complemental strand, 20199573 - 20199455
Alignment:
| Q |
8 |
gaaccagctggtatcgaagaaggaaagaaataattctgcaatgaaatgaatgaatg----ttacactttcaggttatttgagagaacccgatctctcctt |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| | |
|
|
| T |
20199573 |
gaaccagctggtatcgaagaaggaaagaaataattctgcaatgaaatgaatgaatgaatgttacactttcaggttatttgagagaactcgatctctccct |
20199474 |
T |
|
| Q |
104 |
tatccaagactgattcacc |
122 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
20199473 |
tatccaagactgattcacc |
20199455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University