View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-57 (Length: 120)
Name: Solexa-NF5886-57
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-57 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 38039128 - 38039016
Alignment:
| Q |
8 |
tgtttgttgatgggagcatattcaccatcaaaccatgcaagccaccgtctcaaagtaacatcatgtgtaatttcggtaagaaagtttccactgatatcat |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
38039128 |
tgtttgttgatgggagcatattcaccatcaaaccatgcaagccaccgtctcaaagtaacatcatgtgtaatttcggtaagaaagtttccactgatatgat |
38039029 |
T |
|
| Q |
108 |
tctgtatcttgag |
120 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38039028 |
tctgtatcttgag |
38039016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University