View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-6 (Length: 226)
Name: Solexa-NF5886-6
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-6 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 8 - 226
Target Start/End: Original strand, 33017070 - 33017291
Alignment:
| Q |
8 |
agaactacatcaccaatacagccctgagatttagatttcatgtagtgaattatttcaaaagcaacaagcgcattatcgagaatggttctacctcggacaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33017070 |
agaactacatcaccaatacagccctgagatttagatttcatgtagtgaattatttcaaaagcaacaagcgcattatcgagaatggttctacctcggacaa |
33017169 |
T |
|
| Q |
108 |
aagccgcttgctctagagttataaacatggcgagaagaggttttaatctgtttgacaatacctc---ttataggagtataacacattgtaattggtctat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33017170 |
aagccgcttgctctagagttataaacatggcgagaagaggttttaatctgtttgacaatacctcttattataggagtataacacattgtaattggtctat |
33017269 |
T |
|
| Q |
205 |
agtctttgatgctctccggatc |
226 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33017270 |
agtctttgatgctctccggatc |
33017291 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University