View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-63 (Length: 111)
Name: Solexa-NF5886-63
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-63 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 44; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 8 - 51
Target Start/End: Original strand, 32549199 - 32549242
Alignment:
| Q |
8 |
ccaaactcatccacaagtccaaactcatccacttccaggtataa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32549199 |
ccaaactcatccacaagtccaaactcatccacttccaggtataa |
32549242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University