View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-64 (Length: 108)
Name: Solexa-NF5886-64
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-64 |
 |  |
|
| [»] chr1 (16 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 71; Significance: 1e-32; HSPs: 16)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 14 - 108
Target Start/End: Original strand, 9082579 - 9082673
Alignment:
| Q |
14 |
agggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaatcggaacaccaaggcagagc |
108 |
Q |
| |
|
|||||||||||| || || || ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
9082579 |
agggggagtgtcgtacaaggctgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaacctgaacaccaaggcagagc |
9082673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 9096850 - 9096923
Alignment:
| Q |
15 |
gggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
9096850 |
gggggagtttcctataaagctgatgtttatagctttgggatgcttttgatggagatggcaggcaagagaaaaaa |
9096923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 9142912 - 9142973
Alignment:
| Q |
15 |
gggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaag |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9142912 |
gggggagtgtcctataaggccgatgtttatagtttcgggatgcttttgatggagatggcaag |
9142973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 54; E-Value: 2e-22
Query Start/End: Original strand, 15 - 76
Target Start/End: Original strand, 9152465 - 9152526
Alignment:
| Q |
15 |
gggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaag |
76 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9152465 |
gggggagtgtcctataaggccgatgtttatagttttgggatgcttttgatggagatgacaag |
9152526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 18 - 88
Target Start/End: Complemental strand, 9056627 - 9056557
Alignment:
| Q |
18 |
ggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
|||||||| ||||| || ||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
9056627 |
ggagtgtcgtataaggctgatgtttatagttttggtatgcttttgatggaaatggcaagcaagaggaaaaa |
9056557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 8964581 - 8964508
Alignment:
| Q |
15 |
gggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||| | || |||||||| |
|
|
| T |
8964581 |
gggggagtgtcctataaggctgatgtttatagctttgggatgcttttgatggagatggcaggtaaaaggaaaaa |
8964508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 50; E-Value: 4e-20
Query Start/End: Original strand, 15 - 88
Target Start/End: Original strand, 9105032 - 9105105
Alignment:
| Q |
15 |
gggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
|||||||| |||||||| || ||||||||||| ||||||||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
9105032 |
gggggagtttcctataaggctgatgtttatagctttgggatgcttttgatggagatggcaggcaagagaaaaaa |
9105105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 47; E-Value: 2e-18
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 8874112 - 8874182
Alignment:
| Q |
18 |
ggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||||||||| ||||||| | || |||||||| |
|
|
| T |
8874112 |
ggagtgtcctataaggctgatgtttatagttttgggatgcttttgatggtgatggcaggtaaaaggaaaaa |
8874182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 46; E-Value: 9e-18
Query Start/End: Original strand, 15 - 88
Target Start/End: Complemental strand, 8999732 - 8999659
Alignment:
| Q |
15 |
gggggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
||||||||||| ||||| || ||||||||||| ||||||||||||||||||||||||||| | || |||||||| |
|
|
| T |
8999732 |
gggggagtgtcttataaggctgatgtttatagctttgggatgcttttgatggagatggcaggtaaaaggaaaaa |
8999659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 43; E-Value: 6e-16
Query Start/End: Original strand, 38 - 88
Target Start/End: Complemental strand, 9098366 - 9098316
Alignment:
| Q |
38 |
tgtttatagttttgggatgcttttgatggagatggcaagcaagaggaaaaa |
88 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9098366 |
tgtttatagttttggtatgcttttgatggagatagcaagcaagaggaaaaa |
9098316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 34; E-Value: 0.0000000001
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 11033235 - 11033190
Alignment:
| Q |
30 |
aaagccgatgtttatagttttgggatgcttttgatggagatggcaa |
75 |
Q |
| |
|
||||| ||||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
11033235 |
aaagctgatgtttatagttttgggatgttgttgatggagatggcaa |
11033190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 81
Target Start/End: Original strand, 9318334 - 9318397
Alignment:
| Q |
18 |
ggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaaga |
81 |
Q |
| |
|
||||| ||||| || |||||||| ||||| ||||| |||||||||||||| |||||||| |||| |
|
|
| T |
9318334 |
ggagtatcctacaaggccgatgtatatagctttggaatgcttttgatggaaatggcaagtaaga |
9318397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 10979378 - 10979332
Alignment:
| Q |
30 |
aaagccgatgtttatagttttgggatgcttttgatggagatggcaag |
76 |
Q |
| |
|
||||| ||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
10979378 |
aaagctgatgtatatagttttgggatgttgttgatggagatggcaag |
10979332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 76
Target Start/End: Complemental strand, 11010944 - 11010898
Alignment:
| Q |
30 |
aaagccgatgtttatagttttgggatgcttttgatggagatggcaag |
76 |
Q |
| |
|
||||| ||||| ||||||||||||||| | ||||||||||||||||| |
|
|
| T |
11010944 |
aaagctgatgtatatagttttgggatgttgttgatggagatggcaag |
11010898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 11007782 - 11007737
Alignment:
| Q |
30 |
aaagccgatgtttatagttttgggatgcttttgatggagatggcaa |
75 |
Q |
| |
|
||||| ||||||||||||||||||||| | || ||||||||||||| |
|
|
| T |
11007782 |
aaagctgatgtttatagttttgggatgttgttaatggagatggcaa |
11007737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 74
Target Start/End: Original strand, 9234103 - 9234159
Alignment:
| Q |
18 |
ggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggca |
74 |
Q |
| |
|
|||||||| || ||||| ||||| || |||||||| |||||||||||||| |||||| |
|
|
| T |
9234103 |
ggagtgtcgtacaaagctgatgtatacagttttggaatgcttttgatggaaatggca |
9234159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.0000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 82
Target Start/End: Original strand, 15927240 - 15927304
Alignment:
| Q |
18 |
ggagtgtcctataaagccgatgtttatagttttgggatgcttttgatggagatggcaagcaagag |
82 |
Q |
| |
|
||||| || ||||| |||||||| ||||| ||||| |||||||||||||| |||||||| ||||| |
|
|
| T |
15927240 |
ggagtttcgtataaggccgatgtatatagctttggaatgcttttgatggaaatggcaagtaagag |
15927304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.0000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.0000000005
Query Start/End: Original strand, 36 - 76
Target Start/End: Complemental strand, 9159640 - 9159600
Alignment:
| Q |
36 |
gatgtttatagttttgggatgcttttgatggagatggcaag |
76 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
9159640 |
gatgtttatagttttggaatgcttttgatggaaatggcaag |
9159600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University