View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-65 (Length: 107)
Name: Solexa-NF5886-65
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-65 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 9e-52; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 107
Target Start/End: Original strand, 26930704 - 26930810
Alignment:
| Q |
1 |
cataggagtatgatcaaatatggtcccctttgaaggttgtttggggggccaaactgacataagccttcccctttttcacgccttgtccttactgtcttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26930704 |
cataggagtatgatcaaatatggtcccctttgaaggttgtttggggggccaaactgacataagccttcccctttttcacgccttgtccttactgtcttcc |
26930803 |
T |
 |
| Q |
101 |
ctggcta |
107 |
Q |
| |
|
|| |||| |
|
|
| T |
26930804 |
ctagcta |
26930810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University