View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5886-79 (Length: 51)
Name: Solexa-NF5886-79
Description: NF5886
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5886-79 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 40; Significance: 0.00000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000001
Query Start/End: Original strand, 8 - 51
Target Start/End: Complemental strand, 1671172 - 1671129
Alignment:
| Q |
8 |
ccttcagagacagttgtaaaacaactgttgtgtctccataataa |
51 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1671172 |
ccttcagagacaattgtaaaacaactgttgtgtctccataataa |
1671129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University