View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-10 (Length: 145)
Name: Solexa-NF5887-10
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 21065297 - 21065153
Alignment:
| Q |
1 |
gtgagatgaaggatgtgattcaactagtaaagaagagaagaaaagacatagaaaagtgatgatttttataagctccattttcttttgttgaaaggatgca |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21065297 |
gtgaaatgaaggatgtgattcaactagtaaagaagagaagaaaagacagagaaaagtgatgatttttataagctccattttcttttgttgaaaggatgca |
21065198 |
T |
 |
| Q |
101 |
tgagatactttcttaagcaggtgagtttaacttatatactaaacc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21065197 |
tgagatactttcttaagcaggtgagtttaacttatatactaaacc |
21065153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University