View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5887-13 (Length: 142)
Name: Solexa-NF5887-13
Description: NF5887
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5887-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 5e-54; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 5e-54
Query Start/End: Original strand, 19 - 141
Target Start/End: Original strand, 44146153 - 44146275
Alignment:
| Q |
19 |
atatggaaacacccaatttttgtttggtggatatcaacgggtcaaaaacccaaatcactatccaattaaaacaatggcaaattcctgttataattagctt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44146153 |
atatggaaacacccaatttttgtttggtggatgtcaacgggtcaaaaacccaaatcactatccaattaaaacagtggcaaattcctgttataattagctc |
44146252 |
T |
|
| Q |
119 |
tagtgggtaatgattgtcaagat |
141 |
Q |
| |
|
|||||||||||||||| |||||| |
|
|
| T |
44146253 |
tagtgggtaatgattgccaagat |
44146275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 105; Significance: 8e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 8e-53
Query Start/End: Original strand, 22 - 142
Target Start/End: Complemental strand, 33771358 - 33771238
Alignment:
| Q |
22 |
tggaaacacccaatttttgtttggtggatatcaacgggtcaaaaacccaaatcactatccaattaaaacaatggcaaattcctgttataattagctttag |
121 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33771358 |
tggaaacacccaatttttgtttggtggatgtcaacgggtcaaaaacccaaatctctatccaattaaaacaatggtaaattcctgttataattagctttag |
33771259 |
T |
|
| Q |
122 |
tgggtaatgattgtcaagatc |
142 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
33771258 |
tggataatgattgtcaagatc |
33771238 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University